SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08968  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA007735
Annotation
PREDICTED:_probable_multidrug_resistance-associated_protein_lethal(2)03659_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.771
 

Sequence

CDS
ATGGGTGTTGGAAGTGAAAAAGTTGATGAGAAGAAAAAGAAAAAACAATTGCCTACGATGAAAGAGCCTCCCGGAGCGTTTTCTCGTTCGTTATTCTGTTGGATGTTTCCGTTGTTTTATAGAGGGAACTACAGGGATTTAGAAGAAGAAGACTTAGTTCCGCCTAAAAATCAATACAATTCGAAACTAGTCGGAGATCAGCTAGAAAGGGCATGGTTATTGGAGGAGCATAATGCACGAGCAGCCGGTAGAGACCCATCACTTATTAAAGTATTGTTCAAAACATTCGGATGGTCTTTTTTGCCTGGCGGTATTTTGCAATTCGGTTTTGCGATTTTACGTATTATAACACCTCTGTTATTTGGAGAGCTGCTCACGTATTGGACAGTGGATCCGCCTATTACGCAAATGGAAGCGGTATACTACGCACTCAGTATGATAATCATTAACTGGATTGCAGCCTATCTGAACCATCACGGCAATTTATTTTGCTCCCAATTCGGAATGAAACTTAGAATTGCTACAAGCTCTTTGATGTTCAGGAAGGTAATGCGCATGAACAATGGTGCTTTAGGAGACACGACGGCCGGGAAAGTAGTCAATATACTTTCAAACGACCTGCAAAGATACGACAATGCCTTTATATTCTTGCATTTCGTTTGGATCATACCCATACAGTTGGTTGCTGTCTGCTATCTGGGCTACCTTCAAGCTGGTGTTGCAGCTCTCATTGGCTTAGCTTCCCTTGTTGTCATAGCACTCCCTATTCAAGGTGTGCTCGGAAACATTGTGGGAAAAGTTCGCGCCCGGAATGCTGTAAAAACCGATGAGAGGATCAAATTAATGAGCGAAGTCATTAGCGGCATTCAGGTGATCAAAATGTACGCATGGGAAGTACCGTTCCAAAAATCGGTGGCTGAGAAACGTAGCGACGAGCTAAAAGAAGTCCGTACAGCGACTATACTGAGAACCATATTCCTTGGCTTCATGATATTCACAGAGAGGGCTGCACTTTTCATAACAATACTTACTTTTATATTATTGGGTAATGCATTAAGTGCCACTGTGATTTATCCCTTACAACAATTCATGAACGCTGCACAACTCAATATCACATTGATTCTACCTCTCATTCTGACTTTCACTGCCGAATTAATGGTGTCTCTTCGACGAGTTCAGGAGTTTCTCGTCGCAGAGGATCGGCCAGATTTAGTGAAGCGAGATTCATTGATGCCTGCTGGTTCGAACATATTCCGTAATGTAACTGGAAGTTTCCGTAAATCTGAGCCAACTGTTAGACCGCTATCGTACAGCCAGAAAACCGAAATATTACCTACCGACTTCAACTCTAGCAACAATCTGGTAAAACGTAACAATTCAAGACTCTTAAGACGCATGTCTCATCTGGACGACACGGCCGTGGTGTTACACGATGTCTCCGCTAGCTGGACAGGCGACCCAAATTTCTTAGCTATCAAGAATATCTCAATGAAACTCCGCAAAGGGAAACTATGCGTTATCATTGGCGCCGTCGGGTCTGGGAAGTCTTCAATTCTGCAACTGCTTCTAAAGGAATTGCCTCCGGCCACTGGCACAGTTTCAATCTATGGAAAGGTTTCGTACGCCAGCCAAGAGGCGTGGCTTTTCCCTAGTACCGTCCGGGAAAACATACTTTTCGGTTTACCGTTTGAGCCGGAAAAATATAAGATGGTTTGCAAAGCATGTGCATTGGAAAAGGACTTTAAACAATTCCCATACGGAGACCAGACGTTGGTGGGAGAGAGAGGGGTGTCACTATCGGGAGGACAGCGGGCCAGAATCAATTTAGCTCGTTCTGTCTACAGAGAGGCCGACATCTACTTACTGGACGACCCGCTATCTGCAGTTGACGCGAATGTGGGGAGACAGCTTTTTGAAGGCTGCATAAATGGATACCTTCGACAACGCACGAGGATACTTGTCACGCATCAGATACACTTCCTCAAAGCTGCTGACTACATTGTCGTCATGAACGAGGGCCGCATCGAGAACATGGGAACATTCGATGAGCTCACCGCCGCAGGCAAGGCATTCTCCTTGATGTTATCTTCGCTACAAGAAAACAAAGAAAAAGACACCGAAAGTTTGGGATCACGGGGCAAAGAAGAAAAAGAAAATCCGGTTTTATTTAAAAATCAATTGTCTATAATTGAGACTGATGATTTAGAGCAATTTGAAGCTCAGAAGATGGCCGACGAAGAGCGCCAGTCCGGTAATCTAAAGTGGTCAGTGATCGCGGCATACTTCCGAGCCGGAGGAAACATCTGTTTTTTGTTGTTCACCTTTTTGCTGATCATCCTGACAGCGGCTTCCTCGGCTGGCGCTGACTACTGGATCAGTTACTGGACGAATGCAATGGCAGCGTATGACGAAGAGTTAGCAGGTGCTGAAGTGGATACAGGCCTAGATGTTCAAGTGGGACTGTTCACGACCGGCCAATATCTCATGATTCACGGAGCCATAGTATTAGTTACGATTTTCATAACCAATATAAGAGTTATTCCTTTCGCGGAGTTGTGCGTCACCGCTTCGAGTAGACTCCACAACAGCATGTTCTCCACAATGATCAAAGGCATCATGAGGTTTTTCGATACGAGCTCTTCAGGGCGTATTCTCAATCGTTTCACTAAGGACATGGGAGCTTTGGACGAGATATTGCCGAGGACTCTGTTGGACGTGCTTCAAATCTACGCCACTCTTGGAGCTATTCTCGTTTTGAACGCAATCGCACTGTATTGGACATTGATTCCTTCTGTTATACTTCTGACTTTGTTCTACTTCTTTGTCAAAGTCTATCTTAAAACCGCACAAAGCATTAAAAGATTGGAGGGAACAACAAAAAGCCCGGTGTTTGGCATGGTGACGTCATCGCTAAACGGTATAGCTACAATCAGGTCTTCGGGAGCGGAGGACCGATTAATCAGCAACTTCGATGTACTTCAGGACTTACATTCATCCGCCTGGAACGGTTACTTGGGCGGAGGCACCACTTTTGGTTTTTATTTGGACACGATGTGCCTCTTATATCTCACTACCGTTATTTTAGTGTTCATCTTTATAGACTTTGGTAACGTCATTGCCGTGGGAAGTGTCGGTCTGGCAGTAACACAGAGTAACACGCTGACGGCCATGTTGCAACACGGAGCTCGGATGCTGGTAGAGTTCCTCGCCCAGCTTACCAGCGTCGAGAGAGTACTAGAGTATACTAAAATTGAATCGGAGAAGAATCTTTTTGAAGGACAAAAACCGATGCCCCCAACTTGGCCGGCGCATGGAAGAATTATTATGGACAATGTCAGCTTACAGTACGCTCCCGAAGAAGAAGCAGTGCTGAAAAACCTCAACATCGTTATTGAAAGTGGATGGAAGGTCGGTATAGTCGGCAGGACTGGAGCAGGAAAATCCTCACTGATATCCGCCTTGTTCAGATTCGCGTATATCGATGGCTCTATAACTATCGACGGGCTCGACACTTCTGTTATATCGAAACAGGGACTCCGATCAAAAATCTCGATAATTCCGCAAGAACCGGTATTATTCTCTGCGACTATCAGATACAACTTAGATCCGTTCAGCGTGTACAGTGACGACGAGCTTTGGAGGGCGTTAGAACAGGTGGACATGAAAGCGGCCGTTCCTTCGTTGGATTTCAAAGTGACAGAAGGTGGATCTAACTTCTCCGTGGGCCAAAGACAGCTGATGTGCTTGGCACGAGCCATACTCAGATCCAATAAAATTTTAATTATGGACGAGGCCACAGCCAACGTTGATCCTCAAACGGATAATTTCATTCAGCAGACTATACGGCGTGCTTTTGCTTCATGTACCGTATTGACTATTGCACATCGCTTGAACACGATCATGGATTCGGACCGAGTTCTGGTAATGAGTACCGGAGAGGTGGCAGAATTCGATCATCCATACATTCTTATGTCCGATCCCAATAGTCACCTTTCTAGTATGGTACGAGAAACGGGCGAGAAGAATAGCTTAAAGTTATTTGAAGTTGCCAAAGATGCGTATTTCCAAAGTAATCTGAAAGAAAACATGAGATGA
Protein
MGVGSEKVDEKKKKKQLPTMKEPPGAFSRSLFCWMFPLFYRGNYRDLEEEDLVPPKNQYNSKLVGDQLERAWLLEEHNARAAGRDPSLIKVLFKTFGWSFLPGGILQFGFAILRIITPLLFGELLTYWTVDPPITQMEAVYYALSMIIINWIAAYLNHHGNLFCSQFGMKLRIATSSLMFRKVMRMNNGALGDTTAGKVVNILSNDLQRYDNAFIFLHFVWIIPIQLVAVCYLGYLQAGVAALIGLASLVVIALPIQGVLGNIVGKVRARNAVKTDERIKLMSEVISGIQVIKMYAWEVPFQKSVAEKRSDELKEVRTATILRTIFLGFMIFTERAALFITILTFILLGNALSATVIYPLQQFMNAAQLNITLILPLILTFTAELMVSLRRVQEFLVAEDRPDLVKRDSLMPAGSNIFRNVTGSFRKSEPTVRPLSYSQKTEILPTDFNSSNNLVKRNNSRLLRRMSHLDDTAVVLHDVSASWTGDPNFLAIKNISMKLRKGKLCVIIGAVGSGKSSILQLLLKELPPATGTVSIYGKVSYASQEAWLFPSTVRENILFGLPFEPEKYKMVCKACALEKDFKQFPYGDQTLVGERGVSLSGGQRARINLARSVYREADIYLLDDPLSAVDANVGRQLFEGCINGYLRQRTRILVTHQIHFLKAADYIVVMNEGRIENMGTFDELTAAGKAFSLMLSSLQENKEKDTESLGSRGKEEKENPVLFKNQLSIIETDDLEQFEAQKMADEERQSGNLKWSVIAAYFRAGGNICFLLFTFLLIILTAASSAGADYWISYWTNAMAAYDEELAGAEVDTGLDVQVGLFTTGQYLMIHGAIVLVTIFITNIRVIPFAELCVTASSRLHNSMFSTMIKGIMRFFDTSSSGRILNRFTKDMGALDEILPRTLLDVLQIYATLGAILVLNAIALYWTLIPSVILLTLFYFFVKVYLKTAQSIKRLEGTTKSPVFGMVTSSLNGIATIRSSGAEDRLISNFDVLQDLHSSAWNGYLGGGTTFGFYLDTMCLLYLTTVILVFIFIDFGNVIAVGSVGLAVTQSNTLTAMLQHGARMLVEFLAQLTSVERVLEYTKIESEKNLFEGQKPMPPTWPAHGRIIMDNVSLQYAPEEEAVLKNLNIVIESGWKVGIVGRTGAGKSSLISALFRFAYIDGSITIDGLDTSVISKQGLRSKISIIPQEPVLFSATIRYNLDPFSVYSDDELWRALEQVDMKAAVPSLDFKVTEGGSNFSVGQRQLMCLARAILRSNKILIMDEATANVDPQTDNFIQQTIRRAFASCTVLTIAHRLNTIMDSDRVLVMSTGEVAEFDHPYILMSDPNSHLSSMVRETGEKNSLKLFEVAKDAYFQSNLKENMR

Summary

EMBL
AB621548    BAK86406.1    KY646297    AUO38741.1    KM232756    AKC34055.1    + More
KM250380    AKC34056.1    KF926102    AIB06824.1    KF926101    AIB06823.1    KF479232    AHL68987.1    NWSH01001057    PCG72885.1    KY701524    AVV62500.1    AGBW02009058    OWR51776.1    KQ460615    KPJ13567.1    KQ459602    KPI93322.1    KJ930170    AJD79133.1    KJ930168    AJD79132.1    RSAL01000049    RVE50389.1    KX710208    ASU47346.1    KM245562    AKC96181.1    GQ332573    ADH16743.1    ODYU01009083    SOQ53245.1    KJ930167    AJD79134.1    KM245561    AKC96180.1    JN030495    AEI27596.1    KM103521    AIS93186.1    KPI93323.1    SOQ53247.1    KY646296    AUO38740.1    MG387043    AUE23766.1    JN030490    AEI27592.1    KY489760    ASA45739.1    MG387055    AUE23769.1    MG387056    AUE23770.1    GQ332571    ADH16740.1    PCG72886.1    JN030491    AEI27593.1    MG387057    AUE23771.1    MG387058    AUE23772.1    MG387051    AUE23768.1    KF926099    AIB06821.1    ADH16744.1    KM068116    AJY53612.1    MG387068    AUE23775.1    MG387050    AUE23767.1    KF479231    AHL68986.1    MF929077    AVE17269.1    MG387063    AUE23774.1    MG387062    AUE23773.1    KM360184    AKH49600.1    KM360192    AKH49608.1    KX710207    ASU47347.1    AVV62499.1    JQ774504    AFI44049.1    AB620074    BAK82126.1    KJ930171    AJD79136.1    AB620075    BAK82127.1    KC758896    AGO01048.1    OWR51775.1    KP400523    AKV71230.1    KP400524    AKV71231.1    AVV62497.1    RSAL01000187    RVE44791.1    KM245560    AKC96179.1    RVE50388.1    KJ930169    AJD79135.1    ODYU01012016    SOQ58094.1    KF926100    AIB06822.1    NWSH01000412    PCG76566.1    KY484779    ASS36021.1    MH172501    QAA95908.1    GL445398    EFN89664.1    QOIP01000007    RLU20387.1    NWSH01000076    PCG79892.1    GBYB01005573    JAG75340.1    JRES01000264    KNC32832.1    RLU20304.1    KQ977121    KYN05546.1    ABLF02027734    KZ288215    PBC32516.1    RSAL01000046    RVE50566.1    GL888807    EGI58005.1    ABLF02035624    GFDF01003929    JAV10155.1    UFQT01000742    SSX26867.1    ADMH02000892    ETN64739.1    GFDF01003930    JAV10154.1    APCN01002262    APCN01002263    AXCN02000455    GEDC01009088    JAS28210.1    GFXV01002383    MBW14188.1    CH478056    EAT34168.1    KPI93378.1    AAAB01008960    CH902620    EDV31158.2    KK107019    EZA62671.1   
Pfam
PF00005   ABC_tran        + More
PF00664   ABC_membrane
PF16363   GDP_Man_Dehyd
Interpro
IPR003593   AAA+_ATPase        + More
IPR036640   ABC1_TM_sf       
IPR027417   P-loop_NTPase       
IPR011527   ABC1_TM_dom       
IPR017871   ABC_transporter_CS       
IPR003439   ABC_transporter-like       
IPR016040   NAD(P)-bd_dom       
IPR036291   NAD(P)-bd_dom_sf       
SUPFAM
SSF52540   SSF52540        + More
SSF90123   SSF90123       
SSF51735   SSF51735       
Gene 3D
PDB
5UJA     E-value=6.10575e-178,     Score=1608

Ontologies

Topology

Length:
1364
Number of predicted TMHs:
11
Exp number of AAs in TMHs:
248.99929
Exp number, first 60 AAs:
0.81462
Total prob of N-in:
0.94078
inside
1  -  97
TMhelix
98  -  120
outside
121  -  139
TMhelix
140  -  162
inside
163  -  213
TMhelix
214  -  236
outside
237  -  240
TMhelix
241  -  263
inside
264  -  324
TMhelix
325  -  347
outside
348  -  366
TMhelix
367  -  389
inside
390  -  769
TMhelix
770  -  792
outside
793  -  826
TMhelix
827  -  849
inside
850  -  896
TMhelix
897  -  919
outside
920  -  923
TMhelix
924  -  946
inside
947  -  1018
TMhelix
1019  -  1041
outside
1042  -  1364
 
 

Population Genetic Test Statistics

Pi
218.878525
Theta
168.926046
Tajima's D
0.539932
CLR
1.358225
CSRT
0.524673766311684
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号