SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08919
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.15
 

Sequence

CDS
ATGCGCAAACGCCAACACTGGATGACCGATGGTACGCTCGCCCTAATTGAAGAGAGACGTCGAAAGAAAGCTCAAGGCATAGACACGAACAAACTGAATGTATTGTCTGCCAATATTCAGGCCAGCTGCAGACGAGATCATAACTCTCATCTTCGTAACATTTGTGAAGAGGTCGAAAAACATGCTATGAAGCATGAATCTAGAGATCTCTACCACAAAATACGGTTCATTACCAAATCACTGCCATCTAAGACCTGGGCTATTGTAAATGATAAAAACGAACTGATAACAGAGTTGGATCAAATCTCTGAAACATGGAAGAGTTACTGTCAATCGTTATTCCAGGATCCACAGTCACGGCAATTTACAAGTACAGACCCAAACGATGAGGACTTGGAGCCAAGCATTCTCCTGTCTGAGGTTAGGGCTGCTATAAAACACCTCAAAAACAGGAAAGCGACTGGTAGAGATGCAATTCCTATTGAAACAATAAAAGCCTTAGGAGAACGCGGTGACCACATATTTCATAAGATATGCAACAGGGTATGGCAGACGGGAGTTTGGCCGTCGGAATGGACACATACCGTGTTTACTCCCCTGCATAAAAAGGGCTCTACGAAGAAATGTAACAACTATCGTCTAATTGCTCTTACATCACATTCTAGCAAAATTATGTTACATATTCTGAATGAGCGATTAAAAACCTATCTGTCCAAAGAGATTGCTCCGGAACAGGCCGGTTTCGTGAGGGGGAAAGGCACTCGGGAACAAATTTTCATCGTACGTCAGATAATTGAGAAAGCAAGAGAATTCAACAGGCCGACATACATTTGTTTTGTTGACTTCTCCAAAGCATTTGACTCGGTGAAATGGCCTGTTTTGTGGAGGACCTTACTGGATCTGGGGACACCGAAACATCTTGTGCACCTACTGAGACGCTTATATGAGAATGGTACGGCCTCGGTGCGCGCGGATGACGTTCTCTCTGATAACTTCCATCCAAGTGCTGGGGTTCGCCAAGGTTGCATTGTATCGCCGCTCTTATTCAATGCGTACACAGAAATCATAATGCGCATCACTTTGGAGAACTGGACAGATGGTGTAGCAATTGGGGGGTATAGGATTGCAAACTTGCGATACGCGGATGATACCACTTTGTTTGCAACTGATGCGCAATGCTTGGGGGAGTTACTGTCGAGGATGGAACGTGTGAGCCTTGAGTTTGGATTAAAGATTAACCGCAGTAAGACCAAGGTGATGATTGTCGATCGCGCTATGAATAACTCGCCGGACGTGACTCAAATAGCGGGTTGCGACGTGGTCCAGTCCTACATATACCTTGGGGCGTTAATCTCAAATAATGGCGGATGCATGGACGAAATCAGAAGGCGCATGGCTATCACGAGGTCGGCGATGGACGGGCTGAGGAAAGTATGGAGAAATAGAAACATAACCAAAACCACAAAGATCAGGCTCGTTAGAACACTAATATTCTCTATATTTCTATACGCTGCTGAGACGTGGACCGTGCGAGACGTGGAAAGGAAGAAAATAGACGCTCTGGAAATGTGGTGCTGGAGAAGAATGCTTGGAGTTTCGTGGACCGACTTTCGTACAAATGTCTCGATACTTCAGGAACTCGGCATCAAGCAGCGTCTATTTGGTATAGTACAGTCTCGAATGGTGAATTTCTTCGGACACGTTTCGCGACGAGATGGCCGGTCCATAGAACGCCTCGTTGTACAGGGAAGCGTTGATGGTACAAGACCGCGCGGGAGGCCACCAATGCGGTGGACCGACCAAATTAAAACTGCAGTGGGAGGTCCCCTAAATGAGTGCAGTAGAATGGCCTCGAGCAGGGAGAGATGGCGCGACATCGTGAGACGCATCAAGTCTGCCCCTTCCAACACTACATGA
Protein
MRKRQHWMTDGTLALIEERRRKKAQGIDTNKLNVLSANIQASCRRDHNSHLRNICEEVEKHAMKHESRDLYHKIRFITKSLPSKTWAIVNDKNELITELDQISETWKSYCQSLFQDPQSRQFTSTDPNDEDLEPSILLSEVRAAIKHLKNRKATGRDAIPIETIKALGERGDHIFHKICNRVWQTGVWPSEWTHTVFTPLHKKGSTKKCNNYRLIALTSHSSKIMLHILNERLKTYLSKEIAPEQAGFVRGKGTREQIFIVRQIIEKAREFNRPTYICFVDFSKAFDSVKWPVLWRTLLDLGTPKHLVHLLRRLYENGTASVRADDVLSDNFHPSAGVRQGCIVSPLLFNAYTEIIMRITLENWTDGVAIGGYRIANLRYADDTTLFATDAQCLGELLSRMERVSLEFGLKINRSKTKVMIVDRAMNNSPDVTQIAGCDVVQSYIYLGALISNNGGCMDEIRRRMAITRSAMDGLRKVWRNRNITKTTKIRLVRTLIFSIFLYAAETWTVRDVERKKIDALEMWCWRRMLGVSWTDFRTNVSILQELGIKQRLFGIVQSRMVNFFGHVSRRDGRSIERLVVQGSVDGTRPRGRPPMRWTDQIKTAVGGPLNECSRMASSRERWRDIVRRIKSAPSNTT

Summary

EMBL
FJ265560    ADI61828.1    FJ265552    ADI61820.1    FJ265547    ADI61815.1    + More
FJ265546    ADI61814.1    FJ265548    ADI61816.1    FJ265557    ADI61825.1    FJ265553    ADI61821.1    GU815090    ADF18553.1    BDOT01000005    GCF41419.1    BDOT01000017    GCF44634.1    KZ150025    PZC74827.1    GCF44637.1    BDOT01000038    GCF47275.1    BDOT01000002    GCF39993.1    BDOT01000056    GCF48696.1    GCF40259.1    GCF41584.1    BDOT01000150    GCF53030.1    GCF47332.1    BDOT01000054    GCF48631.1    BDOT01000006    GCF41910.1    BDOT01000039    GCF47373.1    BDOT01000101    GCF51279.1    GCF53027.1    BDOT01000094    GCF51020.1    GCF40210.1    BDOT01000077    GCF50202.1    GCF41464.1    BDOT01000022    GCF45061.1    BDOT01000183    GCF53956.1    BDOT01000165    GCF53431.1    BDOT01000105    GCF51450.1    BDOT01000008    GCF42705.1    GCF48632.1    BDOT01000090    GCF50924.1    BDOT01000018    GCF44752.1    BDOT01000069    GCF49674.1    BDOT01000049    GCF48208.1    GCF44732.1    GCF48586.1    GCF41524.1    BDOT01000059    GCF48922.1    NCKU01003098    RWS08177.1    GCF50913.1    GCF48608.1    BDOT01000156    GCF53186.1    BDSA01000081    GBE63537.1    GCF48559.1    GCF47377.1    BDOT01000020    GCF44897.1    NCKU01004395    RWS06003.1    BDOT01000130    GCF52369.1    GCF51029.1    AFYH01119920    BDOT01000031    GCF46561.1    LBMM01007694    KMQ89503.1    BDOT01000127    GCF52252.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF00168   C2
PF01388   ARID
PF02375   JmjN
PF02373   JmjC
PF02928   zf-C5HC2
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR035892   C2_domain_sf       
IPR000008   C2_dom       
IPR030431   FAM189       
IPR016024   ARM-type_fold       
IPR017956   AT_hook_DNA-bd_motif       
IPR039776   Pds5       
IPR003349   JmjN       
IPR001606   ARID_dom       
IPR004198   Znf_C5HC2       
IPR036431   ARID_dom_sf       
IPR003347   JmjC_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF48371   SSF48371       
SSF46774   SSF46774       
Gene 3D

Ontologies

Topology

Subcellular location
Nucleus  
Length:
638
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.33383
Exp number, first 60 AAs:
0
Total prob of N-in:
0.08105
outside
1  -  638
 
 

Population Genetic Test Statistics

Pi
3.175698
Theta
37.530812
Tajima's D
1.097043
CLR
0
CSRT
0.691165441727914
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号