SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08914
Annotation
integrase_core_domain_protein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.343
 

Sequence

CDS
ATGCATTATAGCGGTACTCCTGCTGAGAAACGCGAAGGTCTTACTCCAGAACCTGAAACAGAACAAATTGAAATTCCAGAAAAAAGAAACAACATTAATGAGAACTTACCTTTTCAGGAACCTAACCCCCTTTATTCCAGCTCTAGTCAAGATCATGTTGATGAACCATCTCCCTCAAGTGGAAGACCACAAAGGGACGTGAGACCACCAGCATGGACCAAAGATTATGAGTTAAGTCGCTGCGTGACCATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAACACCTGGGTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGCATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGACTAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAATCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCATAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATCATTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCCACTAGAGAAGACGTTACAAAATTGAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGCGACTCGGATTATGCTGGAGACCCATTGACGCGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACCGAAGCCGAGTACATAGCCGCAGCCGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTACAGGAAATAACCGGTATGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGGTCTAAGCACATAGACGTGCGGTACCATTTTATACATGAACACTTCGTGCATGGATTAATAAATATTAGCTACTGTCCCACAGAAATTCAGTTAGCTGACGTAATGACAAAACCATTGTCAAAAGTAAAATTTGAAAGACACTGTGCAAGATTAATGCATGTATAG
Protein
MHYSGTPAEKREGLTPEPETEQIEIPEKRNNINENLPFQEPNPLYSSSSQDHVDEPSPSSGRPQRDVRPPAWTKDYELSRCVTMFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWVLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSALKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYETNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVIGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIILTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKLKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQEITGMDIKINLHVDNQSSIQLVKSGSFNKRSKHIDVRYHFIHEHFVHGLINISYCPTEIQLADVMTKPLSKVKFERHCARLMHV

Summary

EMBL
GBHO01016409    JAG27195.1    GECL01003258    JAP02866.1    GEDC01029908    JAS07390.1    + More
GBHO01040574    JAG03030.1    GBHO01040573    JAG03031.1    GBHO01006096    JAG37508.1    GBHO01035865    JAG07739.1    GBHO01035869    GBHO01006095    JAG07735.1    JAG37509.1    GBHO01028636    GBHO01028635    JAG14968.1    JAG14969.1    GDHC01005053    JAQ13576.1    GBHO01024362    JAG19242.1    GBHO01012744    JAG30860.1    GBHO01031779    JAG11825.1    GECZ01017843    JAS51926.1    GEZM01048830    JAV76370.1    GGMR01009345    MBY21964.1    GDHC01010945    JAQ07684.1    ABLF02042027    QGNW01002623    RVW14265.1    ABLF02043571    ABLF02045585    ABLF02057174    ABLF02063637    ABLF02063640    GDAI01002967    JAI14636.1    ABLF02026843    KQ971338    KYB28117.1    OIVN01002268    SPD02135.1    JYDM01000512    KRZ81798.1    LBMM01008978    KMQ88491.1    GEZM01078128    GEZM01078127    JAV63002.1    GEZM01013586    JAV92451.1    OIVN01003897    SPD14257.1    KL367655    KFD60665.1    GEZM01002084    JAV97376.1    QGNW01001416    RVW42052.1    OIVN01000183    SPC75833.1    QGNW01000147    RVW91307.1    FJ544857    ACL97387.1    QGNW01001404    RVW42505.1    GEZM01017328    JAV90763.1    OIVN01001052    SPC89229.1    OIVN01001196    SPC91020.1    GEZM01017329    JAV90762.1    OIVN01001091    SPC89740.1    OIVN01001729    SPC97049.1    OIVN01005024    SPD20514.1    OIVN01000147    SPC75222.1    OIVN01000116    SPC74628.1    OIVN01004879    SPD19723.1    OIVN01005312    SPD21871.1    OIVN01001666    SPC96375.1    OIVN01001309    SPC92453.1    OIVN01001520    SPC94877.1    OIVN01002904    SPD07378.1    KQ484038    KYP38095.1    OIVN01001890    SPC98658.1    JYDK01000067    KRX78390.1    KQ484186    KYP36645.1    KQ483417    KYP53032.1    OIVN01000557    SPC82046.1    OIVN01004910    SPD19931.1    OIVN01003569    SPD12194.1    LBMM01012536    KMQ86167.1    CM003607    KYP67664.1    OIVN01005657    SPD23465.1    KQ483702    KYP42748.1    OIVN01002680    SPD05612.1    OIVN01002256    SPD02034.1    FJ544851    ACL97383.1    CM003606    KYP68590.1    OIVN01001669    SPC96464.1    OIVN01001707    SPC96839.1    FJ544856    ACL97386.1    JYDS01000349    KRZ11769.1    OIVN01006259    SPD29117.1    FJ544854    ACL97385.1    JXUM01118474    KQ566190    KXJ70335.1    OIVN01000036    SPC73022.1    OIVN01002725    SPD05963.1    JYDS01000077    KRZ26987.1    OIVN01002854    SPD06945.1    OIVN01004603    SPD18338.1    FJ544853    ACL97384.1    GEZM01017327    JAV90764.1    LBMM01003976    KMQ92933.1    JYDU01000007    KRY00737.1    CM003603    KYP76811.1    KYP76810.1    GEVI01015824    JAU16496.1    CM003610    KYP63120.1    OIVN01005059    SPD20680.1    GEZM01040221    GEZM01040220    JAV80932.1    QGNW01000214    RVW84557.1    NCKU01004452    RWS05910.1    JYDO01000312    KRZ65659.1    JN402333    AFB73912.1    BABH01033959    BABH01033960    JN402332    AFB73911.1    JYDH01000102    KRY32233.1    KRY32232.1    OIVN01000758    SPC85117.1   
Pfam
PF07727   RVT_2        + More
PF13976   gag_pre-integrs
PF00665   rve
PF00098   zf-CCHC
Interpro
IPR013103   RVT_2        + More
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR039537   Retrotran_Ty1/copia-like       
IPR025724   GAG-pre-integrase_dom       
IPR001584   Integrase_cat-core       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
599
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01259
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00141
outside
1  -  599
 
 

Population Genetic Test Statistics

Pi
190.734246
Theta
125.172389
Tajima's D
0.177561
CLR
0
CSRT
0.417079146042698
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号