SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08885
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.896 Nuclear   Reliability : 1.34 PlasmaMembrane   Reliability : 1.346
 

Sequence

CDS
ATGCACTATTTCAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGATAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATTAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCTCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGTAAATTAA
Protein
MHYFKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

EMBL
AB018558    BAA76304.1    KC165845    AFY12622.1    U07847    AAA17752.1    + More
AB055391    BAB21761.1    KQ459580    KPI99178.1    KQ459259    KPJ02068.1    KQ459265    KPJ02064.1    AF081101    AAC72919.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005300    JAB63166.1    GALX01005359    JAB63107.1    KQ971729    KYB24751.1    GGMR01019198    MBY31817.1    GGMS01004685    MBY73888.1    GALX01005299    JAB63167.1    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02042518    ABLF02057746    ABLF02029306    ABLF02029314    ABLF02060138    KQ973342    KXZ75569.1    ABLF02008933    ABLF02003961    ABLF02059872    KK113014    KFM59099.1    GFTR01008038    JAW08388.1    NEVH01012084    PNF30905.1    KK117880    KFM71667.1    GBBI01004571    JAC14141.1    KB632361    ERL93526.1    NEVH01026085    PNF14941.1    NEVH01000598    PNF43535.1    ABLF02019349    ABLF02041900    NEVH01005938    PNF38077.1    NEVH01001355    PNF42855.1    NEVH01010546    PNF32261.1    GEBQ01017345    JAT22632.1    NEVH01003017    PNF40781.1    NEVH01000280    PNF43672.1    NEVH01020071    PNF21969.1    NEVH01007443    PNF35684.1    NEVH01023962    PNF17612.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    NEVH01018383    PNF23463.1    RPOV01000134    RPJ78669.1    ABLF02033757    NEVH01007838    PNF34986.1    NEVH01019964    PNF22161.1    NEVH01006754    PNF36554.1    ABLF02066620    NEVH01014858    PNF27387.1    ABLF02041993    NEVH01011985    PNF31054.1    NEVH01002716    PNF41415.1    GEZM01039082    JAV81425.1    NEVH01023961    PNF17613.1    NEVH01009134    PNF33528.1    NEVH01027074    PNF13841.1    GGMR01004707    MBY17326.1    NEVH01026154    PNF14491.1    NEVH01017470    PNF24199.1    NEVH01019376    PNF22596.1    NEVH01015305    NEVH01006671    PNF27154.1    PNF37357.1    NEVH01017559    PNF23833.1    GBGD01000415    JAC88474.1    GBBI01004395    JAC14317.1    ABLF02008463    S59870    AAB26437.2    JRES01000644    KNC29657.1    DNOY01000259    HBE18313.1    GGMR01016114    MBY28733.1    KK116158    KFM66983.1    NEVH01016327    PNF25684.1    NEVH01021205    PNF19912.1    AF456125    AAL57609.1    ABLF02008153    ABLF02008462    ABLF02008464    AY180919    AAN87272.1    NEVH01019080    PNF22876.1    NEVH01002704    PNF41489.1    GGMS01013269    MBY82472.1    NEVH01017542    PNF24034.1    NEVH01000269    PNF43694.1    GGMR01018716    MBY31335.1    NEVH01006721    PNF37225.1    GGMS01017914    MBY87117.1    GEZM01038405    JAV81653.1    ABLF02016494    ABLF02066976    NEVH01026386    PNF14434.1    KK113137    KFM59425.1    KK115055    KFM64063.1    LBMM01018951    KMQ83660.1    GGFJ01001858    MBW50999.1    ABLF02025082    ABLF02039175    ABLF02041809    ABLF02029291    KK116445    KFM67824.1    GEDC01015644    JAS21654.1    GGFJ01001857    MBW50998.1    NEVH01020963    PNF20308.1    GBGD01002174    JAC86715.1    GBHO01041571    GBHO01005400    GBHO01005396    JAG02033.1    JAG38204.1    JAG38208.1    GFXV01000774    MBW12579.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=0.000912856,     Score=100

Ontologies

Topology

Length:
381
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.570480000000001
Exp number, first 60 AAs:
0.03522
Total prob of N-in:
0.03024
outside
1  -  381
 
 

Population Genetic Test Statistics

Pi
77.316743
Theta
59.119744
Tajima's D
0.862862
CLR
0.068555
CSRT
0.623518824058797
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号