SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08878
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.221
 

Sequence

CDS
ATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACTGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCTAGTAGAAATAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCGAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAACCCATACCCTGGGCCAGGAAGGTCAAGTACCTGGGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTGCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACCTGGGCCTCGAATCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTGCCGCCGCTGACTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAACCTTTGCATTAGATGCCTTCAGCTCTAATACTAGGGGCAGGCTTAGGGACCCCGGTAACCGTACTCGTCGAACTCGACAAAGAGGTCGACGTGCAACCTAA
Protein
MRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDCISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRPLTAGVPQGSVLSPLLFSLFVNDIPRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLGVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLESIRKYMKSASERYFDKAMRHDNRLIVAAADYSPNPDHAGASHRRRPRHVLTDPSDPITFALDAFSSNTRGRLRDPGNRTRRTRQRGRRAT

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ459259    KPJ02068.1    GEZM01008457    JAV94772.1    GALX01005359    JAB63107.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    ABLF02014862    ABLF02014866    ABLF02061908    ABLF02003961    ABLF02059872    GGMS01002955    MBY72158.1    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    GGMS01000737    MBY69940.1    GFXV01007093    MBW18898.1    ABLF02033757    GGMR01018716    MBY31335.1    GGMS01006359    MBY75562.1    GGMR01003407    MBY16026.1    NEVH01006736    PNF36716.1    GFTR01008038    JAW08388.1    GGMR01000676    MBY13295.1    GBBI01001646    JAC17066.1    GGMR01016114    MBY28733.1    ABLF02008463    S59870    AAB26437.2    GGMS01017914    MBY87117.1    GGMS01008766    MBY77969.1    GEZM01053022    JAV74219.1    GEZM01038405    JAV81653.1    NEVH01000269    PNF43694.1    NEVH01020940    PNF20481.1    KK117880    KFM71667.1    ABLF02008153    ABLF02008462    ABLF02008464    GBBI01004571    JAC14141.1    ABLF02034467    GGMS01012005    MBY81208.1    NEVH01006721    PNF37225.1    ABLF02021177    ABLF02027367    ABLF02066338    NEVH01017542    PNF24034.1    NEVH01026386    PNF14434.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBYB01008290    JAG78057.1    GBGD01000880    JAC88009.1    NWSH01000032    PCG80497.1    GGMS01017365    MBY86568.1    GBGD01000799    JAC88090.1    NEVH01022639    PNF18527.1    ABLF02037660    GFTR01008262    JAW08164.1    GFDF01007661    JAV06423.1    ABLF02024246    ABLF02020655    ABLF02039168    ABLF02061060    GGFJ01001857    MBW50998.1    GGMS01002992    MBY72195.1    GEZM01084969    JAV60363.1    NEVH01020071    PNF21969.1    GBBI01001570    JAC17142.1    GFTR01008251    JAW08175.1    GFTR01008256    JAW08170.1    NEVH01023962    PNF17612.1    NEVH01010546    PNF32261.1    GGFJ01001858    MBW50999.1    NEVH01003017    PNF40781.1    NEVH01002704    PNF41489.1    PCG80496.1    NEVH01016302    PNF25823.1    NEVH01007443    PNF35684.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    GGMR01014053    MBY26672.1    AY060438    AAL25477.1    NEVH01012089    PNF30491.1    NEVH01005938    PNF38077.1    GBBI01001642    JAC17070.1    GBGD01000881    JAC88008.1    NEVH01001355    PNF42855.1    NEVH01007393    PNF35987.1    GFTR01008271    JAW08155.1    LBMM01014395    KMQ85192.1    NEVH01011193    PNF32021.1    NEVH01007578    PNF35646.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GFTR01008246    JAW08180.1    AF012049    AAC24972.1    GGMR01003864    MBY16483.1    NEVH01021205    PNF19912.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF07530   PRE_C2HC
PF10551   MULE
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR018289   MULE_transposase_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
627
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
11.9830999999999
Exp number, first 60 AAs:
0.00313
Total prob of N-in:
0.47221
outside
1  -  627
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.535231
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号