SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08877
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.736
 

Sequence

CDS
ATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCATCGGATGCGTTACCACCCGTCACCCCGATAGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACTGTATATCTAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCTATAAAAACACAACTATATTCTGTGTACAGCAGTCTGGCTTAACACGTGTCCCTAGTGAGCTAGTTTTGTTACATCTGAAAAGTTGTTTAGGGCGACTTAGAGAGGTTCAGTTAGGCGAGTATGTAATCACGAGTTTAACGGTGTTAGAAATTCTCAGGTTCATTAAATTATAA
Protein
MRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPIEVKDLIKDLRPRKAPGSDCISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLYKNTTIFCVQQSGLTRVPSELVLLHLKSCLGRLREVQLGEYVITSLTVLEILRFIKL

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    KQ973412    EFA12510.2    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GGMS01002955    MBY72158.1    GECU01013097    JAS94609.1    GGMR01006581    MBY19200.1    KB631961    ERL87484.1    GALX01005299    JAB63167.1    ABLF02040174    ABLF02040183    ABLF02055266    GFXV01007093    MBW18898.1    GBBI01001646    JAC17066.1    GGMR01015412    MBY28031.1    GGMS01006359    MBY75562.1    GBYB01008290    JAG78057.1    GALX01005359    JAB63107.1    ABLF02042385    GFTR01008271    JAW08155.1    KK119316    KFM75364.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    GGMR01013409    MBY26028.1    GGMR01000086    MBY12705.1    KK119261    KFM75202.1    GGMR01000005    MBY12624.1    RPOV01000134    RPJ78669.1    NEVH01006736    PNF36716.1    GGMR01002322    MBY14941.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GEZM01053022    JAV74219.1    GFTR01008251    JAW08175.1    GFTR01007929    JAW08497.1    AY060438    AAL25477.1    GEZM01084970    JAV60359.1    NEVH01019963    PNF22185.1    GGMR01000676    MBY13295.1    GFTR01008256    JAW08170.1    GEZM01084969    JAV60363.1    GGMS01000625    MBY69828.1    GGMS01003914    MBY73117.1    ABLF02017543    ABLF02017549    ABLF02017551    ABLF02021996    GEDC01029594    JAS07704.1    GBBI01001699    JAC17013.1    GGMR01018716    MBY31335.1    GGMS01018022    MBY87225.1    GFXV01002840    MBW14645.1    GGMR01003864    MBY16483.1    GBBI01001642    JAC17070.1    GGMS01009480    MBY78683.1    GGMR01014053    MBY26672.1    S59870    AAB26437.2    GGMR01019198    MBY31817.1    GBGD01000880    JAC88009.1    GBGD01000799    JAC88090.1    ABLF02029306    ABLF02029314    ABLF02060138    GEZM01032972    JAV84478.1    GFTR01008261    JAW08165.1    KK119069    KFM74603.1    GBGD01000881    JAC88008.1    GBBI01003810    JAC14902.1    GGMS01017365    MBY86568.1    GGMR01011511    MBY24130.1    GFTR01008260    JAW08166.1    GBBI01004395    JAC14317.1    GFTR01008169    JAW08257.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
298
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
12.62355
Exp number, first 60 AAs:
0.00861
Total prob of N-in:
0.44974
outside
1  -  298
 
 

Population Genetic Test Statistics

Pi
6.859009
Theta
9.017322
Tajima's D
-0.697483
CLR
0.042144
CSRT
0.19974001299935
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号