SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08836
Pre Gene Modal
BGIBMGA007856
Annotation
PREDICTED:_kynurenine_formamidase-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.317 Nuclear   Reliability : 1.187
 

Sequence

CDS
ATGGACGCATCGACGCGGTGGAAGCCCGAGTGCTTGGTCTTGAGGCTCGTCGTCGTCGCCACGGTGGCTGAACTTCGCATTCAGCTGCGTGAACGCGATCAGGACTTGCTCAGGAATGATATTGGCATCATTGGTTTGCCGGAAGTTCGTGAAGAAAGCACTTGTCATTTAGTCCAGGTTGTGGCGGTAAAACTGGGAGTGAAACTTGACATGCGCGACATAGTTCACGCGGAGCGGATTGGTGCAGTAAGACGCAATTTCATTGAGGGCAACGACAATCGTCCTCGTATACTATCAGTACGACTGGCCCGTCGCTCGGTTCGCGATGCACTATTGAAGGGAGCCCGCGTGCGCCGTAACCTCTCCACTACTGATTTAGATGTACCTGGCCCCGTCCGTAATGTATATTTAAATGAACGTTTGTCCGCATATAACCGCAAGCTGTTTGGTACTACCCGTCAAAAGGGAAAGGATAAAGGTTGGAAGTATGTCTGGACCAAGGACGGACGAATTTATATTCGTCGTGGTGATGGTACTCCTGCGCTCAGAATCAGAGTTCAGGCCGACGTGGAGAAGCATTTTGGCCCGGATACAGATCTAAATATAATACCCTGGTCGAACATCGCCCTCCTGGATGACGTTGACACGATGGTTTACACCTTTTCTATGTTTATTCTGTACCTGTACGATCTCCATGCTCCGCTCAAAACCCTGAAATTCAAAACACGTTCCACTCCTTGGATTACTGATAATGTCCGATTATTGTTTAAATTGCGAGATGCTGCACGCTATAGATCACATGTAACTCAGGTTCATAGTCATAAGCAGTATTATTTAGACCTTAAGAAGCAGGCAACTAGCGTCTTAGCATCGGAAAAAAAGACCTACTACAATAATTATATTAATAGCAACTTCGGAAACCCTAAAAAGTTATGGAAAAATCTGAAATCTGATGTGATTCCGTCACATCAGGAGAAAGCATTGCCTGAACACCTTAATGACGCTAATGCTATCAATGAAGCTTTTCTGGATGTACCCGGGGTCTGTAGTTCTGACGTTTCAGGATACTCATTCTTTGAGTATTCTAACACATCTCCAAAGTTTACGCTTAAAACTGTCAACCAGGATACGGTTCTTAAGATTATTAACAGCATTAAATCCAACGCTCAAGGCACTGACGGGATAAGCGGTGAGATGATATCGCTCTCACTGCCTTCAACATTGGAGGCGATTACTAGCATTATCAATAAGTCCATTGATACAAATACATTTCCTGCTCAGTGGCGATGTTCTGTGGTTAGCCCTATTCCGAAAGTCACGCACCCTCAAGCTTTTAAAGATCTTAGGCCTATTAGTGTGTTGCCTTTTCTGTCCAAGATCTTGGAGAAGGTAGTTTACTCACAGGTAGCGGCATATATCGAATCAAATAACATTCTTCCAGAGTTTCAATCGGGTTCCAGAAAAAGCCGAGGAACGGCCGCTGCTCTTACTGACATTGTGGGTAATATTCTCGAGGCTCGGGACAGGAGCCAGGGTACGATACTGACGCTGCTGGATTTCTCACGGGCTTTTGATACAATTAACACTGCCTTACTCTTAGCAAAATTAACTCACTACGGGTTCTCTGATAATGCTGTGGAATGGTTTAGCAGTTATATGTCGAGTAGAACGCAATTTGTACAAATACGGAAAGAAGATGGAACTAAACTAACCTCTACTTCTAAGCCGATTACTAGAGGCGTTCCCCAAGGTTCTGTCCTGGGACCATTGTTGTTTATTTTGTACAGTGCAGATATCATTCAGTGTTTCAAGAATTGTAAATATCATGTTTATGCTGACGATGTACAATTATACCATTCTTTTGATGTTGGAGATACCCCTTCTGCTGTCAGTTTTATCAATGAGGATCTGCAGAGGATTGTCTCTTGGTCTAAACAGAATTCCTTAGTACTGAACCCCTCTAAGTCTAAATACATGATACTAGGCAGTAAATCTCAGATAGCAAAGATTTTATCACTCGATCCTAAGGTGACTGTTTCTGCTAGCCTAGATGCAGTCATTAAAATACCTCATGAACTGGATATAGAATATGGACCCACATCTGGACAGAAACTTGATATTTTTGGAACGGACCTTCCAAATGATGCTCGGATATTCGTTTACGTCCACGGTGGATACTGGCAGGAACTTTCCCGAGAAATATCCAGATATCCAGTGAAACCGTTTTATCGAGGTGGAATCAAAACGATAATTATAGGTTATGACCTGTGCCCTACGGTTACGCTCGGAGAGATCATCAAAGAGATACAGAATGCTGCTAAATACGTCTTCGAATACGCTGAAAAAATGAACTCTAGGGGCTTATATTTTGCTGGGCATTCGGCTGGAGCTCACCTCGTTTCGAAAATACTTGATAACGCAGAATTACTTCAGAATACCTCCGGCTCTAATCGGCTCCATGGTGTATTTCTCATCTCTGGAGTTTACGATTTACGTGATCTAATCAAGACAACTGTAAATGCTCCTTTAAAATTGAATGAAACAACGGCTGCCGCATTTTCACCGATTCTAAGCAATTATCAACACATACGGGACAGTGATGTGTTTGACAAGATACGGGTGCACATCATAGTCGGAAAACATGACAGTCCCACATTTCAGAAGCAGTCCAGGGATTTTTGGAAAGTTCTGCAATCGAATTTCGGTGTGAATGCTTACCTAGACATTATGGAAAACTTGGATCATTTCGACATAGTCGAAGCGCTCGGAGAACTTGAAAATTACTTGAAATTTTTTATATCAAACAGTTTCTGCGATTAA
Protein
MDASTRWKPECLVLRLVVVATVAELRIQLRERDQDLLRNDIGIIGLPEVREESTCHLVQVVAVKLGVKLDMRDIVHAERIGAVRRNFIEGNDNRPRILSVRLARRSVRDALLKGARVRRNLSTTDLDVPGPVRNVYLNERLSAYNRKLFGTTRQKGKDKGWKYVWTKDGRIYIRRGDGTPALRIRVQADVEKHFGPDTDLNIIPWSNIALLDDVDTMVYTFSMFILYLYDLHAPLKTLKFKTRSTPWITDNVRLLFKLRDAARYRSHVTQVHSHKQYYLDLKKQATSVLASEKKTYYNNYINSNFGNPKKLWKNLKSDVIPSHQEKALPEHLNDANAINEAFLDVPGVCSSDVSGYSFFEYSNTSPKFTLKTVNQDTVLKIINSIKSNAQGTDGISGEMISLSLPSTLEAITSIINKSIDTNTFPAQWRCSVVSPIPKVTHPQAFKDLRPISVLPFLSKILEKVVYSQVAAYIESNNILPEFQSGSRKSRGTAAALTDIVGNILEARDRSQGTILTLLDFSRAFDTINTALLLAKLTHYGFSDNAVEWFSSYMSSRTQFVQIRKEDGTKLTSTSKPITRGVPQGSVLGPLLFILYSADIIQCFKNCKYHVYADDVQLYHSFDVGDTPSAVSFINEDLQRIVSWSKQNSLVLNPSKSKYMILGSKSQIAKILSLDPKVTVSASLDAVIKIPHELDIEYGPTSGQKLDIFGTDLPNDARIFVYVHGGYWQELSREISRYPVKPFYRGGIKTIIIGYDLCPTVTLGEIIKEIQNAAKYVFEYAEKMNSRGLYFAGHSAGAHLVSKILDNAELLQNTSGSNRLHGVFLISGVYDLRDLIKTTVNAPLKLNETTAAAFSPILSNYQHIRDSDVFDKIRVHIIVGKHDSPTFQKQSRDFWKVLQSNFGVNAYLDIMENLDHFDIVEALGELENYLKFFISNSFCD

Summary

Uniprot
ProteinModelPortal
PDB
4E15     E-value=5.95536e-34,     Score=364

Ontologies

Topology

Length:
939
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.50679
Exp number, first 60 AAs:
1.34588
Total prob of N-in:
0.08282
outside
1  -  939
 
 

Population Genetic Test Statistics

Pi
230.499314
Theta
176.81295
Tajima's D
0.962817
CLR
0.260901
CSRT
0.649567521623919
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号