SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08832
Annotation
blastopia_polyprotein_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 3.448
 

Sequence

CDS
ATGCATGAGACAATGAGCAGACGGAAAAAACAACCCAATGAGTCGTTTTATCAATATATGCTCGTAATGAAAGAACTCGGAAAAAGAGCTAAGTTTCCGGATTACGTCGCGATTCAGTATATAATCGACGGAATATCTGACTATGAATCTAACAAGTTGTTATTCTACGGGGTAACGTCGTATTCTGTGCTCAAGGAGAAATTAGTATTATATGAAAGTTTCAAAGAGAAGTCCAAAAAAAGTGTTGATACCATGAGACGAGGTCAGCGAGACACGGCGGTAATGCCTAGACAGGTTCATCGATGTTACAATTGTGGTGAAAGAGGGCACCTATCTAGTTCCTGCCGCAGAGGTATCAAATGCTTCAAGTGCAACGGGTTCGGGCACAAGGGTACGGAGTGCCGCGCATCACAAGGTATGGAAGCTAAAAAAGCATCAAATAATTATTATGGAGGAGGTGATGAACAAGATCGGCGATCTATGTTTGTTCGACAGCAGGAGGACGACGAGAAGAACGAGAACGAACTATACGAACGTGAGCAATGCGATTTAAAAGAGCAAGTGAGTGAAATGCCAAATTTTAGTTGTCAACAACTAAATCATATTGTTTCGTCAAATTTATTAAGTGTAAACAAACGTGATTCTATAAACATGAGTGTAAAATCAGTAAAAGTTGGTAACTATGTGACTAATTGTTTAATTGACACAGGTAGCGACTTAAATTTAATAACTTTTGATTTGTTTACAAAACTAAAATGCGAGTACATACCAGAAAAAATGTTGCTTACTGGGTTAGGAAGTTCTAAAGTATTTTCGATTGGTAAGTTCGACACAGATTTAACTATTGACAGTCACAGATATAGTGTTAATTTGTATATTGTACCTACAGGTGGAATACCATATGATGTAATACTGGGTCAACAATTTTTAGTAAATACTATCACAGTTATTGACAAGGGTTTGGTTGAGGTCAGGCCTCCTTGTTATGACATATCGTATCAAAATGCTATCTGTCTATCTTCCAGTAGCGATGACCACTGTACAGCGGTGAGGGAAATTATTGACAGTTACACACCTTTGAAGACTAAAGATGCACCTATCAGGCTGAAGATTGTGTTGAAGGATGATGTACCAGTTTCACAAAGACCAAGACGACTAGCCATCACTGAAGAACAGTTAGTTAAGCAGCATGTTGATGCATTGAGCAGAAACATACTTTTTGTTGATGTCGAGTTACATGCAAGAGTGAAGAAGGCTCAAGCAGATGACGAAAGTTTGAAGGTTATCAGAAAAATCTTAGAAGAAAATGAGTATGAAGATTATTTCCTTGAGAATGGAGTTATTTACAAGGGTATAGAAAAGAAGTTGGTGTTACCTAAGATACTGGATATGGAAATTATTAAGAAAGCACATTGTACAGGACACTTTGGTAAAAAGAAGATAAGGGATATTATAGAGAAAGATTACTTTATTACTAAATTAGATAGCAAAATTGAAAAAGTAATTTCTACATGTGTACCATGTCTATTAGCAAGCAGGAAGTCTGGAAAGAAGGAAGGTTTGTTAAATCCCATAGAAAAAGGAGAATTACCACTGGATACTCTTCACTGTGATCACCTAGGACCCTTAGATGCAACTAAGAAAATGTATAACTACATACTTACTATAATTGATGGATTTACAAAGTTTGTGTGGATTTATCCAGTCAAGACTGTAACAGCAAAAGAAACTGTGGAAAAATTGAGATTACATCAAAAGGATTTTGGCAACCCACGGAGGATTATCACTGACCGAGGTACAGCATTCACAGGCAGTGAGTTCCGAGAATATTGTGAAGAAGAAGACATCGAACATGTTACAATCACTACTGGAATACCTCGTGGAAATGGCCAAGTAGAACGCATGAACAGTATTATTATTTCTGCGTTGACAAAGATGTGTATTGAAGAACCTGGTCACTGGTACAAATATACAAGCAAACTACAACAAGTGATAAACAGCACATACCAGCGGGCAATCTATACTACACCATTCGAACTGTTAACAGGAGTGAAACTTAAACTGAAAGAAGATTTATCAATTTTAGAATATTTAGAAGAAGAAAATAGATTGCAATTTATGAATAGGAGAGAAGAAGCACGAAGAGAAGCCAAAGCTCAGATTTTAAGAATGCAAGAGGAGAATAGAAAGACTTATAATAAACGACGTAAAGTAGGAGAAATGTACAAGGTTGGAGATCTTGTAGCTATTCAAAGGACACAATTTGGGAACGCCCTAAAATTGAAACCTAAATTTTATGGACCATATCGCATCACTAGGGAAATGGGGAAAGGTCGATATGAGGTCGAAAAAATAGACAGAAGCAAAGATGGGCCAGTACGAACTACATCAGCATTAGATTTCATGAAGAGGTGGCCTTGA
Protein
MHETMSRRKKQPNESFYQYMLVMKELGKRAKFPDYVAIQYIIDGISDYESNKLLFYGVTSYSVLKEKLVLYESFKEKSKKSVDTMRRGQRDTAVMPRQVHRCYNCGERGHLSSSCRRGIKCFKCNGFGHKGTECRASQGMEAKKASNNYYGGGDEQDRRSMFVRQQEDDEKNENELYEREQCDLKEQVSEMPNFSCQQLNHIVSSNLLSVNKRDSINMSVKSVKVGNYVTNCLIDTGSDLNLITFDLFTKLKCEYIPEKMLLTGLGSSKVFSIGKFDTDLTIDSHRYSVNLYIVPTGGIPYDVILGQQFLVNTITVIDKGLVEVRPPCYDISYQNAICLSSSSDDHCTAVREIIDSYTPLKTKDAPIRLKIVLKDDVPVSQRPRRLAITEEQLVKQHVDALSRNILFVDVELHARVKKAQADDESLKVIRKILEENEYEDYFLENGVIYKGIEKKLVLPKILDMEIIKKAHCTGHFGKKKIRDIIEKDYFITKLDSKIEKVISTCVPCLLASRKSGKKEGLLNPIEKGELPLDTLHCDHLGPLDATKKMYNYILTIIDGFTKFVWIYPVKTVTAKETVEKLRLHQKDFGNPRRIITDRGTAFTGSEFREYCEEEDIEHVTITTGIPRGNGQVERMNSIIISALTKMCIEEPGHWYKYTSKLQQVINSTYQRAIYTTPFELLTGVKLKLKEDLSILEYLEEENRLQFMNRREEARREAKAQILRMQEENRKTYNKRRKVGEMYKVGDLVAIQRTQFGNALKLKPKFYGPYRITREMGKGRYEVEKIDRSKDGPVRTTSALDFMKRWP

Summary

Uniprot
ProteinModelPortal
PDB
5UOQ     E-value=7.46799e-29,     Score=320

Ontologies

Topology

Length:
806
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.32486
Exp number, first 60 AAs:
0.00603
Total prob of N-in:
0.01310
outside
1  -  806
 
 

Population Genetic Test Statistics

Pi
297.576712
Theta
185.894682
Tajima's D
2.403535
CLR
0.761863
CSRT
0.933853307334633
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号