SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08786
Annotation
PREDICTED:_uncharacterized_protein_LOC106720812_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 2.34
 

Sequence

CDS
ATGCAACGAACACAGGTCGAGAGCTTTTCTATAGAATTTCTTCATATCCTGAACTCGAAGCCTATTCCTCCGAACAGTCGTCTCAGAAAACTGTCACCGGCTTTGGGAGAGGACAAATTACTGCGGTTAGCCGGAAGAATTAAAGCCGCAGAAGGCATTGACCCTGACACGCGCTTCCCCGTCCTTCTTGACGGTCGTCACCCAATTGTACGTTTATTGGTACAATTTTATCATCGAAAAGCGGGTCACGCAAATTATGAACTAGTCGTGAACGAATTAAGACAAAAATTCTGGTTGTTAAGGCTGAGGAACACAGTGAGAACAGTAGCAAAAGAGTGTCCACTCTGCAGAATTAGAAAGTCCTTGCCGGTGAACCCGAAAACAGGAGATCTGCCACCTGAAAGATTAGCTCACCATCGACGGCCCTTTACTTTTACGGGTCTGGACTACTTCGGCCCCGTAAGCGCCACTATCGGGCGCAGGCATGAAAAACGTTATGTAGCCCTTTTCACCTGTTTAACTGTCAGAGCCCTTCACCTAGAAATGGTACATAGTCTATCGACTGACTCTGCTATCATGGCTATTAGAAGATTCATTGCAAGACGGGGCTGTCCAAACATTATTTTCTCGGACAACGGAACCTGCTTTGTTGGTGCCAATCGCATTCTCAGAGGTTTCTACGGAGAAAATGTCGAAGATTTCACAAGCACTCAAGGAATACTCTGGAAGTTCATCCCACCTGCGGCACCTAATTTCGGAGGATGTTGGGAGCGCTTGGTGCGATCAGTAAAGGTAGCTCTGAACGCAACATTAACCGAACGAGCTCCAAAAGAAGAAACCTTGAGCGTCTTACTAGCCGAGGCAGAAGCCATTGTCAATTCACGTCCATTAACTCATGTATCTACAGATCCTGACGACCCGACAACACTCACACCATTTCATTTCTTAATCGGTTCTTCGTCCGTGCAGACCTTACCTACTGCCTTGAACGATCACGATTTGGTCAGCCGTTCCGAATGGAGGAAAGCATTGAGGCTAGCAGATCATTTTTGGTCGCGTTGGATGCGCGAGGTTCTCCCGACCCTACAACCACGTGAGCAGTTAAGAGGCAACCGCAGTTCAACAGCTTTTCAAGAGGGTGACGTAGTAATTATTGCTGACTTTAACTTGCCCCGCGGAATATGGCCACGAGGACGTGTTGCGAAAGTGTACCCTGGGAAAGATGGCGTGATAAGGGTAGTGGACGTTGCAACAGCAGGGGGAATGCTACGCCGACCCGTACGAAAGCTGGTTAGGCTCTCCACCTAA
Protein
MQRTQVESFSIEFLHILNSKPIPPNSRLRKLSPALGEDKLLRLAGRIKAAEGIDPDTRFPVLLDGRHPIVRLLVQFYHRKAGHANYELVVNELRQKFWLLRLRNTVRTVAKECPLCRIRKSLPVNPKTGDLPPERLAHHRRPFTFTGLDYFGPVSATIGRRHEKRYVALFTCLTVRALHLEMVHSLSTDSAIMAIRRFIARRGCPNIIFSDNGTCFVGANRILRGFYGENVEDFTSTQGILWKFIPPAAPNFGGCWERLVRSVKVALNATLTERAPKEETLSVLLAEAEAIVNSRPLTHVSTDPDDPTTLTPFHFLIGSSSVQTLPTALNDHDLVSRSEWRKALRLADHFWSRWMREVLPTLQPREQLRGNRSSTAFQEGDVVIIADFNLPRGIWPRGRVAKVYPGKDGVIRVVDVATAGGMLRRPVRKLVRLST

Summary

EMBL
KQ459986    KPJ18861.1    RSAL01000375    RVE42106.1    AB042118    BAA95569.1    + More
AB042119    BAA95570.1    RSAL01000010    RVE53755.1    NWSH01008670    PCG62455.1    ODYU01003174    SOQ41584.1    AF530470    AAQ09229.1    KZ149895    PZC78807.1    AAZX01023278    LNIX01000019    OXA44812.1    LNIX01000039    OXA39294.1    OXA44855.1    JXUM01009840    KQ560293    KXJ83223.1    GDHC01018323    JAQ00306.1    GEZM01063488    GEZM01063487    JAV69084.1    GAMC01017930    JAB88625.1    LNIX01000004    OXA56250.1    JXUM01130316    KQ567562    KXJ69370.1    JXUM01144298    KQ569759    KXJ68523.1    JXUM01020113    KQ560564    KXJ81881.1    LNIX01000007    OXA52015.1    LNIX01000015    OXA46575.1    JXUM01083542    KQ563383    KXJ73941.1    JXUM01162450    KQ574455    KXJ67869.1    LNIX01000003    OXA57597.1    JXUM01005801    KQ560202    KXJ83866.1    JXUM01049477    KQ561606    KXJ78017.1    KL363318    KFD47687.1    AJVK01033431    JXUM01139649    KQ568932    KXJ68836.1    JXUM01122819    KQ566647    KXJ69950.1    AJWK01027898    JXUM01151198    KQ571164    KXJ68235.1    GGFJ01005957    MBW55098.1    KL367737    KFD59786.1    JXUM01013377    KQ560375    KXJ82728.1    AAGJ04095911    GEZM01052586    JAV74401.1    KL367480    KFD71819.1    GGFJ01000333    MBW49474.1    AJVK01037041    KL367650    KFD60758.1    JXUM01146045    JXUM01146046    GCES01094753    JAQ91569.1    JXUM01031097    KQ560909    KXJ80382.1    GGFJ01000306    MBW49447.1    JXUM01147607    KQ570400    KXJ68371.1    GBYX01183181    JAO85198.1    AJVK01058515    UFQS01001404    UFQT01001404    SSX10721.1    SSX30403.1    UFQT01000590    SSX25539.1    GGFL01001842    MBW66020.1    JXUM01136032    KQ568367    KXJ69026.1    GGFL01001682    MBW65860.1    GGFJ01005956    MBW55097.1    GAKP01020709    JAC38243.1    KL363300    KFD48215.1    GEHC01000913    JAV46732.1    AAAB01008847    JXUM01020939    KQ560586    KXJ81781.1    JXUM01038372    KQ561162    KXJ79503.1    KL367508    KFD68106.1    JXUM01080154    KQ563168    KXJ74353.1    KL367556    KFD64382.1    AERX01020956    LSMT01000016    PFX33015.1    KL367515    KFD67354.1    JXUM01016534    JXUM01056823    KQ561926    KQ560461    KXJ77135.1    KXJ82302.1    KL363212    KFD53967.1    KL367687    KFD60188.1    JXUM01049933    KQ561627    KXJ77955.1    AAGJ04011066    OXA55241.1    UFQS01000284    UFQT01000284    SSX02410.1    SSX22785.1    JXUM01103818    KQ564835    KXJ71674.1    KFD67336.1    GEHC01000921    JAV46724.1    AAGJ04122915    GDIP01004568    JAM99147.1    GDIP01036233    JAM67482.1    JXUM01127084    KQ567147    KXJ69602.1    KL367553    KFD64595.1    KFD53864.1    GAKP01004189    JAC54763.1    GCES01107353    JAQ78969.1   
Pfam
PF05585   DUF1758        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF03564   DUF1759
PF00069   Pkinase
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF06677   Auto_anti-p27
PF00078   RVT_1
PF10607   CLTH
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR005312   DUF1759       
IPR036305   RGS_sf       
IPR000961   AGC-kinase_C       
IPR000719   Prot_kinase_dom       
IPR000239   GPCR_kinase       
IPR017441   Protein_kinase_ATP_BS       
IPR011009   Kinase-like_dom_sf       
IPR016137   RGS       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR019787   Znf_PHD-finger       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR011011   Znf_FYVE_PHD       
IPR009563   SSSCA1       
IPR000477   RT_dom       
IPR019786   Zinc_finger_PHD-type_CS       
IPR006594   LisH       
IPR006595   CTLH_C       
IPR024964   CTLH/CRA       
IPR021109   Peptidase_aspartic_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF56112   SSF56112       
SSF48097   SSF48097       
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       

Ontologies

Topology

Length:
435
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.23009
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01995
outside
1  -  435
 
 

Population Genetic Test Statistics

Pi
226.340108
Theta
170.410555
Tajima's D
1.094967
CLR
0.503198
CSRT
0.687065646717664
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号