SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08782
Pre Gene Modal
BGIBMGA005903
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Integrin beta       + More
Guanylate cyclase      
Location in the cell
Nuclear   Reliability : 4.077
 

Sequence

CDS
ATGGATAAAATTACAAGTTTGTTGGAATCTATTCAAATTGAACAAAAACTCCAAAAGGAAGAGATGAGAGAAATGCAAAAAAATATAACAAAGAGTATTAACAATAACATAAATGAAAAATTTAACGAAATGGATCTCAAGTACAAACACTTGGTTGAAAAATTGGATATTCAAGAAAAACAAATAGATTACTTAGAGAGAGAAAACAAAAGGAGAAATTTAGTTTTTTTCGGAATAGAAGAAGAAGAGAGAAGTTACTTCCAGCTTTATACAAAAGTAACTTACATAATAACGATGAACATGAAGTTATCTTGTGAGAAATACGATATAGAGAACATTAAACGTATCGGTAAGAAAGGAAACAAAGTTAGGCCCGTTATAGTAACCCTTACAACACTAGGAAAAAAGATAGAGATCCTGAAGAATAAAAAATCTCTAGCAAGCACGTCATATTATATACAAGAAGATTATCCTAAAAAAGTTTTGGAGACAAGAAAATCTTTGAAAGTTACAGTGGAAGAACTCAGACAGGAAGGAAAGGCTGCAATCATTAAATACGATAAGTTAATAATTTTAGAGGATAAACTACCAAAACAACATCAACATTCCAAAAAGAGAATGCTCACACCGTCTCCAGTTACTCAAAATAACGCAAAATATAAAAAAAATAGAGAGCAGAATAAGTTAAGCAGGTCAGATATAGCTAGTTTCTTCGTTCCACAAACCGACAATGAGAAGCCCTCTCAGAAAATAAAAATAGACGTATTAGGCTTGGCAGAAGTCAGGAGAATGGGATGCAATATTGAAGAACATGAAGATTATATCTTCTGCTACAAAGGAGAAACGCCAGGCTTGTATGGTGTGGGCTTCTTAGTTAAGAAAGAGCATAAAAACAAGATACTAAGCTTCTCAGGCCTATCCGAACGCGTGGATATGCTGCAGATTAAATGTAACAATACGACACTGTCAATAATACAAGCCTACGCCCCTACAGAGAGAGCACCAGAGGAGGATATCAATCTATTCTACGAAACTCTAGAAACAGCGCTAAGCCAGGCAGGCAGACATGTTCTTCTTCTCGGCGACTTTAACGCTCAGGTAGGTCAGACAAGCACGAACGATAGTATAGTCATGGGAAAATTCGGATACGGAAAACGAAGCGAGAGAGGGGAAAGGCTTGTGCAATATGCCTTGGAAAACAAACTATCGATCATGAATACATTTTTTAAAGCCAGGAAAAATCGTAAATGGACATGGCTGTCTCCCGATGAAAATACTAAAAATCAAGTAGATTTTATTCTATCGAACGAACGAAAAAAGATAAGGAAGTTAGATGTTCTCAACGCCTTAGGATTTAGATCAGACCATCGCCTAGTCAGAGTTACATACATGCTAAAAAAAGAAAAGGAAAGCAGAACAACATTTAAATCACAACCTAAGCCCCTCAAAACAGAAGAAGATATTAGCTGCTATTTGCAGAACTTAAAACAAAACATACAAGAATTGAACACACAAAACGACGAACACGACGTACAAACATACTACAATACATTAGAAAATGTTATTAATAAGAGCATGCCATCAAAAAAGAAGGAGCCAAAAGTAGATACTGTTGGAAAAATTCTCAGTAAACATACACTGGATATGCTCAGAAAACGAACAGAACTAGTACAAAAAAAACCAAAAACTGAGGAAATGAAAAAGGAATTAAGTACTTTGTATAAATCAACAAGCAAGGCCATAAAAAAAGATTACCAAAATCATAGAAATAGAATAATAGAGGAGAACCTACATAAATTTAGAAGTTCCAAAAGAGCATACAAACAGCTAACAACACACAAAAACTGGATCCAAACCCTAAAAACAAGCACCAAAGAGACCAAAACTAGAGACAGTGTAATAAATTGTGCTACAGAATTTTTTAAAGTACTATATGGCATGAAAGCTGACATCTCTTCGAGTTCAATTGCTTATTATTCTAGTAAGGACTGCAAGTATTGTAAAATCGCTTCGGAGAAGGTTGATATAGCACCAATAAGCGGTAAGGAAATTATCAAACACATTAAAAAGATGAAGCAAGACAAAAGCCCAGGACCCGATGGTTTACAAAATGAGGCTATAAAGACTGGTTCTACTTTGTTAATTCACCCTCTTACTTACTTGTTTAACAAAGTACTCGATACTGGGGAAGTGCCAGAACAGTGGAAAAGATCCGATATAATCTTACTGCTCAAAAAGGGAGATCCAAATGACATAGGCAACTACAGGCCTATTAGCCTCCTTTCGAGTATGTACAAGCTATTCACATCAATTTTACAAAGCAGAATGACTCCAAAAATTGATGAACACCAGTCGATCGAACAAGCAGGTTTCCGTTCGGGTTTTTCGACAATAGATCATATACATGTTATACAACAAGTTATAGAGAAATATAAAGAGTTCAATAGACCACTGTACATAGCTTTCATCGACTATGCTAAAGCCTTCGATACAATCGTACATAATTTCATATGGAAAGCCCTAGATAAATGTCACGTTCATGATAAATACATAAAAATATTAAAAAACATCTATGATGGAAGTATCAGCAGAGTCAAACTGGAAAAACGGGGAGAGGACATAAAAATCTGCCAAGGAGTAAGACAGGGTGATCCTTTGTCGCCTAAGCTGTTTATAGCAGTACTACAGCTTATCTTTGAAAATGTACACTGGCCATCGAACGGAATCAAAGTAAATGGGAAGCGACTTACACATTTGAGATTTGCTGATGATATCGTTCTCTTCGCTGAAACAAACGAAAAACTCGAAAAAATGATAAATATTTTAAGCGAGGAAAGCGAAAAAGTCGGTCTCAAAATGAACCAAGACAAAACCAAAGTAATGACAAACAGTAGTGCTGATAAAATCAGCTTGTATGGCAAACCGTTAGAGTACGTAAACAGCTATATATATCTCGGAAAATTAATTTCATTTAAAGACAACAACGATGAAGAAGAAGTCGAACGCCGAATCAATATAACTTGGAGAAAATTCTGGAGCTTAAAGGAAATTCTAAAAGGGTCCTTCCCTCTTCATCTGAAAAAGACTGTGATGGATACCTGTATTCTTCCGACTCTCTTATATGGGTGCCAAACATGGACTTACAACACAAAAATAAAAACAAAATTAGCGACCTGTCAGAAAGCGATGGAAAGAAGTATATTGAATATAAGAAAAATACAAAGGATAAGAAGCGAATACATTAGAGAAAAAACAAAGCTGATAGATGCTCTCAGGTACGCTCTGACACAAAAGTGGCGCTGGGCAGGACATCTTGCGAGATATACGGATAAAAGATGGACATTAGAAATTACAACATGGGAAGGACCAGCGGGCAAAAGAAGAAGAGGACGACCAAGAAGCAGATGGATCGACGAAATAACAGCAGCAACTGGAAAAGAATGGAGAAACAAAGCCAAGGATAGGGAAGAGTGGAGCAAGCTGGAGGAGGCCTATACCCGAATGGGGTTTCAAGCACAAGTTTATATTTAA
Protein
MDKITSLLESIQIEQKLQKEEMREMQKNITKSINNNINEKFNEMDLKYKHLVEKLDIQEKQIDYLERENKRRNLVFFGIEEEERSYFQLYTKVTYIITMNMKLSCEKYDIENIKRIGKKGNKVRPVIVTLTTLGKKIEILKNKKSLASTSYYIQEDYPKKVLETRKSLKVTVEELRQEGKAAIIKYDKLIILEDKLPKQHQHSKKRMLTPSPVTQNNAKYKKNREQNKLSRSDIASFFVPQTDNEKPSQKIKIDVLGLAEVRRMGCNIEEHEDYIFCYKGETPGLYGVGFLVKKEHKNKILSFSGLSERVDMLQIKCNNTTLSIIQAYAPTERAPEEDINLFYETLETALSQAGRHVLLLGDFNAQVGQTSTNDSIVMGKFGYGKRSERGERLVQYALENKLSIMNTFFKARKNRKWTWLSPDENTKNQVDFILSNERKKIRKLDVLNALGFRSDHRLVRVTYMLKKEKESRTTFKSQPKPLKTEEDISCYLQNLKQNIQELNTQNDEHDVQTYYNTLENVINKSMPSKKKEPKVDTVGKILSKHTLDMLRKRTELVQKKPKTEEMKKELSTLYKSTSKAIKKDYQNHRNRIIEENLHKFRSSKRAYKQLTTHKNWIQTLKTSTKETKTRDSVINCATEFFKVLYGMKADISSSSIAYYSSKDCKYCKIASEKVDIAPISGKEIIKHIKKMKQDKSPGPDGLQNEAIKTGSTLLIHPLTYLFNKVLDTGEVPEQWKRSDIILLLKKGDPNDIGNYRPISLLSSMYKLFTSILQSRMTPKIDEHQSIEQAGFRSGFSTIDHIHVIQQVIEKYKEFNRPLYIAFIDYAKAFDTIVHNFIWKALDKCHVHDKYIKILKNIYDGSISRVKLEKRGEDIKICQGVRQGDPLSPKLFIAVLQLIFENVHWPSNGIKVNGKRLTHLRFADDIVLFAETNEKLEKMINILSEESEKVGLKMNQDKTKVMTNSSADKISLYGKPLEYVNSYIYLGKLISFKDNNDEEEVERRINITWRKFWSLKEILKGSFPLHLKKTVMDTCILPTLLYGCQTWTYNTKIKTKLATCQKAMERSILNIRKIQRIRSEYIREKTKLIDALRYALTQKWRWAGHLARYTDKRWTLEITTWEGPAGKRRRGRPRSRWIDEITAATGKEWRNKAKDREEWSKLEEAYTRMGFQAQVYI

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
Similarity
Belongs to the integrin beta chain family.
Feature
chain  Integrin beta
EC Number
4.6.1.2
EMBL
ODYU01008249    SOQ51673.1    FJ265562    ADI61830.1    FJ265563    ADI61831.1    + More
FJ265564    ADI61832.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    FJ265561    ADI61829.1    GBGD01000380    JAC88509.1    GBBI01004876    JAC13836.1    FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265544    ADI61812.1    FJ265549    ADI61817.1    FJ265543    ADI61811.1    FJ265545    ADI61813.1    RSAL01000057    RVE49824.1    FJ265551    ADI61819.1    JARK01001655    EYB84321.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    JARK01000173    EYC41342.1    JARK01000388    EYC37469.1    JARK01001370    EYC16150.1    JARK01001354    EYC21986.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01001568    EYB89432.1    JARK01001353    EYC22263.1    JARK01001348    EYC25048.1    EYC25050.1    EYC16376.1    JARK01001473    EYB97806.1    EYC25049.1    EYC25046.1    QFQQ01000179    PZR20596.1    GBBI01004877    JAC13835.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001711    EYB81734.1    GL379822    EGT48339.1    JARK01001543    EYB91356.1    GDKW01001596    JAI54999.1    JARK01001424    EYC04315.1    EYC04317.1    EYC04316.1    EYC04314.1    JARK01001389    EYC11015.1    JARK01001730    EYB81048.1    JARK01001639    EYB85201.1    EYC25145.1    DS268591    EFO92565.1    EYC21713.1    GBGD01000453    JAC88436.1    JARK01001736    JARK01001462    JARK01001379    JARK01001338    EYB80775.1    EYB98943.1    EYC13646.1    EYC33347.1    DS268444    EFP01729.1    JARK01001438    EYC02111.1    JARK01000460    EYC36749.1    JARK01001340    EYC30828.1    JARK01001621    EYB86109.1    JARK01001475    EYB97550.1    JARK01000302    EYC38674.1    JARK01000109    EYC42952.1    JARK01001626    EYB85833.1    JARK01000314    EYC38488.1    EYC31464.1    JARK01001497    EYB95322.1    EYC33297.1    EYC30744.1    JARK01001432    EYC03125.1    EYC10874.1    JARK01000063    EYC44387.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01001581    EYB88505.1    JARK01001344    EYC28216.1    JARK01001372    EYC15614.1    JARK01001401    EYC08686.1    JARK01000165    EYC41537.1    JARK01001421    EYC04912.1    JARK01001357    EYC20551.1    JARK01000008    EYC46079.1    EYC10025.1    EYB95049.1    JARK01000161    EYC41641.1    JARK01001612    EYB86585.1    JARK01001618    EYB86258.1    JARK01000204    EYB98081.1    EYC40601.1    JARK01001582    EYB88498.1    JARK01001531    EYB92324.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF00362   Integrin_beta
PF03372   Exo_endo_phos
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR032695   Integrin_dom_sf       
IPR036465   vWFA_dom_sf       
IPR015812   Integrin_bsu       
IPR002035   VWF_A       
IPR002369   Integrin_bsu_VWA       
IPR029052   Metallo-depent_PP-like       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
SUPFAM
SSF56219   SSF56219        + More
SSF53300   SSF53300       
SSF69179   SSF69179       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
PDB
6AR3     E-value=0.000718051,     Score=106

Ontologies

Topology

Subcellular location
Membrane  
Length:
1176
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02454
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1176
 
 

Population Genetic Test Statistics

Pi
258.586318
Theta
165.278755
Tajima's D
2.019583
CLR
26.595369
CSRT
0.885755712214389
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号