SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08774
Pre Gene Modal
BGIBMGA005783
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_[Bombyx_mori]
Full name
PiggyBac transposable element-derived protein 4      
Location in the cell
Mitochondrial   Reliability : 1.702 Nuclear   Reliability : 1.745
 

Sequence

CDS
ATGTTACAGTCACTAGTTATAGATTATGTGGAGCGCGAATATTGGTATGCCGTGATTGAAGAACTCCAAATAGGCAATTTTAAAGAAATAATGACTTATAACCGTTTCATCGTCATCAAACGTTGTCTCCATTTTATAGACAATGCCACTTTGCCCGTGCCGCCTACCAAACTCGATAAAATCATCCCCATCATAGAGCACCTAAACAAAAAATTTAAGTCTTTATACGTACTAGAACAAAATATAGCAATTGACGAGTCACTCCTTCTTTGGAAGGGGCGCCTCTCATTTGCGCAAAAAATTGCTACAAAAAGAGCTCGAGTAGGTATAAAGTCTTACGAGTTATGTGAATCCAGGACTGGATATTTATGGCAGATCGAGGTCTACACGGGCAAAGGGCACGCACATGTGGTACAAGACGGGGAGCCGGAAGAGCGCGGGCAAGAGTCTGACGAGCCGGAGAGTGCCACGGCCCAGATTGTGCTGAACTTAACGAGACCACTTTTTGATAAAGGCCATACATTAATAATGGACAATTTTTATAATGCGCCACTTTTGTCTCGGATCCTAAAAGTTCAGCACAAGACTGATTCGATGGGTACTCTACGACTTAACAGAGAGTTTGTCCCCGAAGCTCTTAAAAAAAAAACAAAAAAAAACATGAAGGAGGGCGAGGTGGCATTCAGCACAACCAAAGACCTCAGTGTGGTTGTGTGGATGGACAAAAATATTGTGGCAATGATTTCTTCTTTCCATCCCATAGAAGTCGGCGGCATTGAAAAATACGGTTATTACCGGTACAAACCGCAAGTTGTTCTTGATTATAATTTCTCAATGGGCGGCATCGACCACAAAGATCAAATGCTGTCTGCCTATCCCATTGAGAGATCACGTAACATAATCTGGTACAAAAAATTATTTCGCCGACTTTTAAATGTATCGATGCATAATGCTTTCGTAATGTTCAACCACAACCGCACTCACGCCCTTCGTCACCGTGAATTCCGCCTGCAGTTGGCAAAGCAACTGCTGCAAAGCAGCAGATCAGCAGCACCTTCCCGGTCTTTAGCACCGGCAGCACGACCAGAACCAGCGGCATGCATACGGGACATGCACTTGCCAGGAAAAAATACAAAAAAACAGCGCTGCAAGCTCTGCTACTCTGCCAAAGTGCAGCGCTCGACGGTGTGGCGGTGTACCACCTGCAATGTTAATCTGTGTATCATAGGATGCTACACCGTATACCATATCAATCTAGCGCAAACGCCCGCCGTTTAG
Protein
MLQSLVIDYVEREYWYAVIEELQIGNFKEIMTYNRFIVIKRCLHFIDNATLPVPPTKLDKIIPIIEHLNKKFKSLYVLEQNIAIDESLLLWKGRLSFAQKIATKRARVGIKSYELCESRTGYLWQIEVYTGKGHAHVVQDGEPEERGQESDEPESATAQIVLNLTRPLFDKGHTLIMDNFYNAPLLSRILKVQHKTDSMGTLRLNREFVPEALKKKTKKNMKEGEVAFSTTKDLSVVVWMDKNIVAMISSFHPIEVGGIEKYGYYRYKPQVVLDYNFSMGGIDHKDQMLSAYPIERSRNIIWYKKLFRRLLNVSMHNAFVMFNHNRTHALRHREFRLQLAKQLLQSSRSAAPSRSLAPAARPEPAACIRDMHLPGKNTKKQRCKLCYSAKVQRSTVWRCTTCNVNLCIIGCYTVYHINLAQTPAV

Summary

Keywords
Complete proteome   Reference proteome  
Feature
chain  PiggyBac transposable element-derived protein 4
EMBL
RSAL01000003    RVE54733.1    KZ150197    PZC72319.1    RSAL01000024    RVE52239.1    + More
NWSH01000091    PCG79681.1    NWSH01005605    PCG64100.1    JTDY01002247    KOB71806.1    ODYU01010513    SOQ55669.1    RSAL01000138    RVE46171.1    ODYU01011285    SOQ56924.1    KQ459989    KPJ18766.1    KZ150113    PZC73303.1    RSAL01000132    RVE46376.1    PZC73302.1    RSAL01000030    RVE51668.1    RSAL01000093    RVE47894.1    NWSH01005160    PCG64390.1    NEVH01015827    PNF26532.1    RSAL01001012    RVE40990.1    NEVH01017475    NEVH01002684    NEVH01001351    PNF24176.1    PNF41738.1    PNF42927.1    NEVH01026401    NEVH01025126    NEVH01020854    NEVH01013255    NEVH01000629    PNF14193.1    PNF16176.1    PNF21085.1    PNF29260.1    PNF43158.1    NEVH01017440    PNF24625.1    NEVH01009069    PNF34004.1    NEVH01026393    PNF14286.1    NEVH01021985    PNF18924.1    NEVH01027063    NEVH01021202    NEVH01002692    PNF13962.1    PNF19936.1    PNF41621.1    RSAL01000056    RVE49901.1    NEVH01026109    PNF14626.1    RSAL01000155    RVE45659.1    RSAL01000097    RVE47692.1    JU326601    AFE70357.1    NEVH01016950    PNF24933.1    CM001282    EHH62949.1    CM001259    EHH27175.1    AQIA01062119    AK057200    AK094816    AK289491    AC079203    NWSH01000726    PCG74565.1    CABD030095328    JSUE03037923    ABGA01233763    NDHI03003689    PNJ08370.1    AHZZ02030739    NEVH01011876    PNF31583.1    AQIB01116437    AACZ04060380    GABC01006592    GABD01003812    GABE01001690    NBAG03000487    JAA04746.1    JAA29288.1    JAA43049.1    PNI20010.1    NEVH01000252    PNF43842.1    NEVH01026090    PNF14815.1    GEGO01006047    JAR89357.1    GEGO01007089    JAR88315.1    RSAL01000872    RVE41088.1    NWSH01008683    PCG62453.1    KZ150119    PZC73218.1    GL434615    EFN74736.1    HAAD01001920    CDG68152.1    RSAL01000075    RVE48877.1    NEVH01023953    PNF17885.1    LSMT01000021    PFX32631.1    KK116918    KFM69084.1    GEDC01003168    JAS34130.1    KK116466    KFM67844.1    RSAL01000045    RVE50637.1    NEVH01017534    PNF24104.1    GL445643    EFN89283.1    GL439981    EFN66430.1    GL445759    EFN89132.1    GEZM01089191    JAV57612.1    NEVH01018384    PNF23441.1    ODYU01000749    SOQ36006.1    PYGN01005712    PSN29180.1    NEVH01024959    PNF16251.1    NEVH01009368    PNF33480.1    GECU01037003    GECU01013756    JAS70703.1    JAS93950.1    GECU01010268    JAS97438.1    ABLF02014543    ABLF02028765    GEBQ01026738    GEBQ01000704    JAT13239.1    JAT39273.1    RJVU01079141    ROI15640.1    KK116246    KFM67179.1    GECU01033435    GECU01003618    JAS74271.1    JAT04089.1    NEVH01020944    PNF20410.1    NEVH01006563    PNF38066.1    NEVH01024425    PNF17185.1    GECU01027411    GECU01021505    JAS80295.1    JAS86201.1    KK118582    KFM73344.1    NEVH01015302    PNF27192.1    ABLF02023363    ABLF02023369    ABLF02055317    GEZM01013350    GEZM01013349    GEZM01013347    GEZM01013346    GEZM01013345    GEZM01013342    JAV92637.1    GEBQ01017560    JAT22417.1   
Pfam
PF13843   DDE_Tnp_1_7        + More
PF13842   Tnp_zf-ribbon_2
PF17913   FHA_2
PF01094   ANF_receptor
PF02017   CIDE-N
Interpro
IPR018159   Spectrin/alpha-actinin        + More
IPR029526   PGBD       
IPR032718   PGBD4_C_Znf-ribbon       
IPR041388   FHA_2       
IPR000253   FHA_dom       
IPR008984   SMAD_FHA_dom_sf       
IPR028082   Peripla_BP_I       
IPR001828   ANF_lig-bd_rcpt       
IPR003508   CIDE-N_dom       
IPR000315   Znf_B-box       
SUPFAM
SSF49879   SSF49879        + More
SSF53822   SSF53822       

Ontologies

Topology

Length:
425
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.28524
Exp number, first 60 AAs:
0.00132
Total prob of N-in:
0.00864
outside
1  -  425
 
 

Population Genetic Test Statistics

Pi
159.479042
Theta
156.875237
Tajima's D
0.396992
CLR
14.554168
CSRT
0.484875756212189
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号