SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08733
Pre Gene Modal
BGIBMGA004947
Annotation
reverse_transcriptase_[Lasius_niger]
Location in the cell
Nuclear   Reliability : 4.192
 

Sequence

CDS
ATGGAATGTGTTATGTCGTGCCATCCGGCTGACCCCCGGCGCTCCCCGGTACCCGGGCCGGAGAGTGAGAAATTTGCTACCGAAGACCTCACTGAAGTAGGTGACCAGGCTTCAGTGTTCGTTAATGCTACTGGAAACAAGAAGAAACTAGTGCAGCAGGCCCTTCACCCAGGTTTATTTACCAGGGCCAAGAGTATGTCTATGAGCAACATACCAAACACCCAAACCAAAGAAAGCTCCTCTCAGCTGGATGCTGAAATGCAGCAATCAGATTTAGAAACAGTCACCCAGTGCTCCCAAATATCAAAACCACCAGACTGGCAAAGAGTTCCCATTCTACGCCATCCAAAAAAAAGAAAATTATCCTCCAAACCTTCTCCCGAATTAATAAAAACAACAAACAGCTTTAGCGGACTTCCGATAGATCAGCCGGAATATAGGGCGAGAGATGCAAAAGACAAGAAAACTAATAAACCTCCACCTATAATCTTGTACGGAATTGAGGATGTTCATAAGCTCACTGAACTCCTAGAAACCGCAACAGATAGATCTAATTTCTCTTTTAAGATTATTAGCAGAAACCAACTTAAAGTTTTATCAGTGGACCTGGAGATATACAAGAAGGTAATAACTGTTATACGAGAACATGGACTAATAGGACACACCTTTAACAGAAAAGACCAAAAATCCTACAGGATCGTTATAAGAAATCTCCACCACACTACTCCTACTACTGCTATCAAAGAGGCTATTGAAGAGAGTGGCAACACAGTAGTAGGTGAGATTATTAATGCCAAATTTGGTCCCGACAAAAAACCCACTTCTACCTTTTTTGTAAATTTGCTTCAGGGTCCTAATAATAGAGCTTCTAGGGATATTAGATTTATATATCATCAAGCTGTTACTATTGAAGAACCCAGAAAAAGATCCAGTGTAGTGCAATGTCAAAGATGTCAGCAATATGGTCATACCAAAAACTATTGTATGAAACCATATCGCTGTGTCAAGTGTGCTGGACCGCACAAAACTTCGGAATGCACAAAAGTGGATCGCAATACACCTGCTTTATGTGCATTGTGTTTAGGACCCCACCCAGCAAATTATAAAGGCTGTGAGGTATACAAGGAAATCCTATCAAGGAAAACCTCGCAACACTTACCACGTAAACATAAGCAATTTGAGTATAAACCTCAAAAAAATAAGGAAGAAACTGATTATAAAACATCTGCAAATCAGAATAAAGAGGAAATTCAACCGCTGCAGGAGCAGAGGAAAGCACATGAGCACAAATCGTATGCCGATACGGTCAGATCTCAGAGTCTAGACATTCTCCTAATTTCAGAGACACATATGACGACCAGCAGCTCGATAAGAATTAAAGGATATAAGATCTATTCCACAAATCACCCAGACGGTACAGCCCACGGCGGGACAGCAGTGATAATCAAAGCCACTGTTAGACACCATGTGCTACCAAACTACTGTACCGAACATATCCAGGCTACCACAGTAGCAGTCAGTGACAGAAATGGAGACTTTAATATATCATCAATTTATTGTCCCCCGAAACATAAAATAAGTGAAGCACAGTTTTCTGACTACTTTTTAAGCTTAGGATACAGATTTATTGCTGGGGGTGACTGGAATGCGAAGCATTCGCACTGGGGCTCTAGATTAATAACTACACGTGGAAGGGAGCTGAAGAAAAGTGTAGATAAACAGTTTTTGACTACTGTGTCAACTCCAGAACCAACACACTGGCCCACAGACCAGAACAGACTGCCAGACGTTCTAGACTTTTTCATCACAACAGGACTGTCTCGACTGTTCTTCAATGTTGAGTCATGCCTCGATAGCTCATCTAACCATATTCCTGTAATATTGACAGTGAGCACCACTATTCTTAAGAAAGAAGTTCGGCAAACATTGTACAACAAATACACAGACTGGGATAGCTTCCGGGAAATAGTTGATACGGAGCTAAGCCTAAAAATAGCACTTAAAACAGAAGAGGATATCGAAGAAGCCACAAAGCATTTCACCACAACAGTTCAAGCTGCCTGCTGGAAAACCTCTCCGGAGCACTTGAATCCCAGGCCACGGCAAAATAAGATATCGTTTGAAATAAAAGAACTGATTCTGAACAAAAGAAAACTGCGAAGAGTATGGCATACTAGCAGGCTCTCAGTAGATAAAAGAGCTCTTAACAAAGCAGTCAAGGATCTTAAACTTGCCATAAAAAATGTAAGGGACAAAACTATGGAATGTTATCTAGATTCCTTAACTGCAACAAGTGCTACTAACTACTCTCTATGGCGAGCTTGTAGGAACTATAATAGGCCTATGGATCCCAAACCGCCGTTACGGTTGCAGAATAACACTTGGGCAAGAACAAGACAAGAAAAAGCTGACGCCTTTGCTGTTCACTTAGCAAAAGTATTCACGCCTAATGATGCTGACCCAAACACTGATGATTCCTTCATAGATTCGGCCCTAAGTCAAGACTTCCAGCTCGATTTGCCGATTAGGCCTACAACTCCGAAAGAAGTCGTGGCAACAATCTCAAAATTGGAGGACAAAAAAGCCCCCGGGTTTGATTTAATAGACAAAAAAGTCTTGAAGGAACTTCCCAAAAAAGCCATAGTTTTTCTAACCATCTTATTTAATGGCATACTAAGAACTGGACACTTTCCATCACTGTGGAGAGTTTCACAAGTAATTATGATACCTAAAGTAGGGAAGCCAGTGAACGAACTTAGCTCATACAGGCCGATTAGTCTACTAACCGTAACGTCAAAACTTTTTGAGTCAGTCCTGCTGCACAGATTATTGGAGGAGATTCATCAAAGAGCCATAATCCCGGACCACCAGTTTGGCTTTCGCCAGCAGCATGGCACTGTGGAACAAGTCCATAGAATCTGCTCTGTGATAAGGAAGGCACTAGAGAGAAAGGAGTACTGCTCCTCTGCCTTCCTAGACGTGCAGCAAGCGTTTGATAGAGTATGGCACAAAGGTCTCTTGTATAAAGTAAAAACTCTTCTACCCTGTACATTCTTCCCCATCATAAAATCTTATCTAACAGAAAGAATATTTCAAATAAGAGAAGAAGAGTGTACATCGCCATTTCACTCAATCAAAGCTGGTGTACCGCAGGGGTCTGTCCTGGGTCCAGTCTTGTATACCATTTACACATGTGATTTACCACAAAGCGAACATGTTACATTAGCAACATTCGCAGACGATACCGCTGTACTGGCATGTAGCAATTGCCCAAACGAAGCTTCAGACTTCCTACAGACTGGATTGCAAGAAATTGAAACCTGGCTTTCAAAGTGGAGAATAAAAACTAGTGTGACAAAATCCGTTCATGTAACCTTCACCCTCCGTAGAGGAGACTGTCCGCCAGTAACTCTGTGCAATCAACAACTCCCGCAAGAACACTGCGTAAAATACTTGGGAATACACCTTGATAGGAGACTCGTATGGAAACAACACATACAGAAGAAGAGAGAAGAAATCAACCTGAAATACAGAGGACTCTACTGGCTGCTTGGCAGAAATTCCAAGCTGTCAGTAGATAATAAGCTACTCATCTACGAAATGCTCTTGAAACCAATTTGGACATACGGGATTCAACTATGGGGTTCGGCGTGTGACTCTAACATAAATATCATACAGAGGGTTCAAAATTACATCCTGAAACAAATATCGAACTGTCCGTGGTTTATAAAAACATCGGAGATTCATGAACACCTCAAAATCAGGACTGTTAAACAGGAAATCAAGACCTGGAGTATGAAATACAGAAAAAGGCTAGAAATGCATCCTAATAAGCTTGCCACGCAACTAACCACACCGGACCTAATAAATAGGCTTAAAAGGCGACAAATCCTAAGTCTTGATAGACACAGTTGA
Protein
MECVMSCHPADPRRSPVPGPESEKFATEDLTEVGDQASVFVNATGNKKKLVQQALHPGLFTRAKSMSMSNIPNTQTKESSSQLDAEMQQSDLETVTQCSQISKPPDWQRVPILRHPKKRKLSSKPSPELIKTTNSFSGLPIDQPEYRARDAKDKKTNKPPPIILYGIEDVHKLTELLETATDRSNFSFKIISRNQLKVLSVDLEIYKKVITVIREHGLIGHTFNRKDQKSYRIVIRNLHHTTPTTAIKEAIEESGNTVVGEIINAKFGPDKKPTSTFFVNLLQGPNNRASRDIRFIYHQAVTIEEPRKRSSVVQCQRCQQYGHTKNYCMKPYRCVKCAGPHKTSECTKVDRNTPALCALCLGPHPANYKGCEVYKEILSRKTSQHLPRKHKQFEYKPQKNKEETDYKTSANQNKEEIQPLQEQRKAHEHKSYADTVRSQSLDILLISETHMTTSSSIRIKGYKIYSTNHPDGTAHGGTAVIIKATVRHHVLPNYCTEHIQATTVAVSDRNGDFNISSIYCPPKHKISEAQFSDYFLSLGYRFIAGGDWNAKHSHWGSRLITTRGRELKKSVDKQFLTTVSTPEPTHWPTDQNRLPDVLDFFITTGLSRLFFNVESCLDSSSNHIPVILTVSTTILKKEVRQTLYNKYTDWDSFREIVDTELSLKIALKTEEDIEEATKHFTTTVQAACWKTSPEHLNPRPRQNKISFEIKELILNKRKLRRVWHTSRLSVDKRALNKAVKDLKLAIKNVRDKTMECYLDSLTATSATNYSLWRACRNYNRPMDPKPPLRLQNNTWARTRQEKADAFAVHLAKVFTPNDADPNTDDSFIDSALSQDFQLDLPIRPTTPKEVVATISKLEDKKAPGFDLIDKKVLKELPKKAIVFLTILFNGILRTGHFPSLWRVSQVIMIPKVGKPVNELSSYRPISLLTVTSKLFESVLLHRLLEEIHQRAIIPDHQFGFRQQHGTVEQVHRICSVIRKALERKEYCSSAFLDVQQAFDRVWHKGLLYKVKTLLPCTFFPIIKSYLTERIFQIREEECTSPFHSIKAGVPQGSVLGPVLYTIYTCDLPQSEHVTLATFADDTAVLACSNCPNEASDFLQTGLQEIETWLSKWRIKTSVTKSVHVTFTLRRGDCPPVTLCNQQLPQEHCVKYLGIHLDRRLVWKQHIQKKREEINLKYRGLYWLLGRNSKLSVDNKLLIYEMLLKPIWTYGIQLWGSACDSNINIIQRVQNYILKQISNCPWFIKTSEIHEHLKIRTVKQEIKTWSMKYRKRLEMHPNKLATQLTTPDLINRLKRRQILSLDRHS

Summary

Pfam
PF00078   RVT_1        + More
PF07530   PRE_C2HC
PF14529   Exo_endo_phos_2
PF04937   DUF659
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D
PDB
1WDU     E-value=0.0149291,     Score=95

Ontologies

GO

Topology

Length:
1304
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06714
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1304
 
 

Population Genetic Test Statistics

Pi
322.679371
Theta
210.283227
Tajima's D
1.895141
CLR
46.105562
CSRT
0.863706814659267
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号