SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08732
Annotation
PREDICTED:_uncharacterized_protein_LOC101737183_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.218 PlasmaMembrane   Reliability : 1.24
 

Sequence

CDS
ATGACTTCGCGCGGGAAAGTCATTCAAAATGTCCCTAACTATTGTCGGATCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGTTAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCTTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTCCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGCTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAGGTGGCGGGCTGAACTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTTACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MTSRGKVIQNVPNYCRIAPAMDAPPDYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTVRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAIFRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYRWRAELRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078930    BAC06454.1    + More
AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01003679    KMQ93242.1    LBMM01008682    KMQ88705.1    LBMM01005733    KMQ91252.1    LBMM01006954    KMQ90166.1    GGMR01000779    MBY13398.1    GGMR01014195    MBY26814.1    LBMM01002052    KMQ95336.1    ABLF02011238    GGMR01015159    MBY27778.1    LBMM01019839    KMQ83438.1    LBMM01006110    KMQ90925.1    LBMM01007425    KMQ89740.1    GGMR01004600    MBY17219.1    GFXV01002090    MBW13895.1    LBMM01006063    KMQ90967.1    LBMM01005465    KMQ91492.1    ABLF02013358    ABLF02013361    ABLF02054869    LBMM01014122    KMQ85315.1    LBMM01003245    KMQ93755.1    ABLF02034925    GGMR01011682    MBY24301.1    ABLF02014378    ABLF02018808    GFXV01003903    MBW15708.1    ABLF02059310    GGMR01006838    MBY19457.1    ABLF02004854    ABLF02041317    ABLF02005203    ABLF02041316    GGMR01015354    MBY27973.1    ABLF02023257    GGMR01019493    MBY32112.1    GALA01001777    JAA93075.1    KU543683    AMS38371.1    ABLF02004597    ABLF02041324    GGMR01012748    MBY25367.1    LBMM01004262    KMQ92649.1    LBMM01004261    KMQ92650.1    GGMR01009778    MBY22397.1    ABLF02023401    ABLF02029423    ABLF02060278    HACL01000281    CFW94575.1    GEHC01000964    JAV46681.1    GALA01000302    JAA94550.1    LBMM01006977    KMQ90149.1    GALA01001776    JAA93076.1    GGFJ01001453    MBW50594.1    AJ278684    CAB99192.1    GGFJ01001454    MBW50595.1    ABLF02020969    AAZX01001144    AB090817    BAC57910.1    M93691    AAA29365.1    GALX01004171    JAB64295.1    AB090813    BAC57902.1    GGFL01001192    MBW65370.1    GGFL01004046    MBW68224.1    ABLF02009709    ABLF02009711    ABLF02028779    AB090816    BAC57908.1    ABLF02018471    ABLF02058352    ABLF02011136    ABLF02014426    ABLF02009073    ABLF02030702    ABLF02042963    GGFJ01001841    MBW50982.1    LBMM01013668    KMQ85535.1    GGFK01007771    MBW41092.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00098   zf-CCHC
PF13966   zf-RVT
PF13359   DDE_Tnp_4
PF12017   Tnp_P_element
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR026960   RVT-Znf       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
6AR3     E-value=5.58581e-06,     Score=122

Ontologies

Topology

Length:
632
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.48976
Exp number, first 60 AAs:
0.00014
Total prob of N-in:
0.01326
outside
1  -  632
 
 

Population Genetic Test Statistics

Pi
176.122451
Theta
25.838699
Tajima's D
2.031468
CLR
148.530677
CSRT
0.889905504724764
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号