SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08728
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.933
 

Sequence

CDS
ATGGAATCTCATGACATCTCCATACTAGGCATCAGTGAAACTCACATGCGTGGTAATGGCCACTTCACCACTGTGACAGGGAACACCATGTACTTCTCAGGCTGTGAAGATTCAAGTTTGAGTGGAGTCGGAATCATATTGCCGCCACACTTAAACAAATATGTCCTCGGTTATAATCCGGTGTCTGATGGAATCTTGACAATGAAACTGAATACCAATCCATGTGTGCTGAATGTAATACAGATATACGCACCGACGGCACAAGCACAGGATGAGTTAATTGTGGACTTCTATGGAAAACTGGAGGAAATACTGAATTCTATACCTAGTCGGGAAATTAAGATAATTCTTGGTGATTGGAATGCCAAAGTTGGCAGTACACTGGATGATAATCATATCAGGAGCACAGTTGGAAAATTTGGACTTGGCATTAGGAATGAACGGGGTGAAAAACTGATCGAGTTCTGCATTGAAAGAAATCTCAGTATTATGAACACGTACTTCCAACATCATCCAAGACGCTTGTACACGTGGAGATCTCCAGGCGACAGGTACAGAAATCAAATCGACTACATCATTCTAGATGGCCGCTGGAGATCCTCAGTATCTAACGTGAAGACCTTTCCCGGCGCAGAGTGCGGCTCCGACCATAACCTGCTCGTAGCTAACTTCTCGCTGCGTTTAAAGGCGCCCAGACGTCAACCACCAAAACCCAATAGTTTGGATCCTTCCGAACAACCAATCTTCCGAGAGGCATTAGAGGCGATCTTGAAGGATTCTCCAGCGCACATTCACGCTAACGCTGATACACAGTGGAAACACTTGAAAGGTCATATCAACGATGCGCTGGACCAGATCGCTAAAAAGAAAAAGCCAGAACCGAAGAAAAAATGCTGGATCTCCGATCATTCGTGGGAGCTTATTCAACGCAGAAAAGACTTAAAAACTAGCGGTTTGCAAGATGGTGCAAAAGTTAAATACTCCGAACTTAGCAGAGCTATTCGGGTCAGTTGTCGCCTTGACAAGAACCACTTTGTTGAGGGTATTTGCCGTGACATTGAGCGCTTCTCGAACAAGTTGCAGACTGCAGACCTTTTTAAGAAAGTTAGAGTCCTTTCCAGGCAGTTCAAGGCTAAATCGTGGGTCATAAGAGATGCCGACGGAACTGTACTACACGAGTTCGACCGCATTGCCGAGAGATGGCGGGCGTACTGTGAGCAATTGTATACAGATTCCCACTCGACATCCGGGATTAATCCTGAATGGAAGGATCTAGAACTGGAACCCATGATTTTACCTTCCGAAATATCCACCGCACTGGAATCTCTTAAGAAGAATAAGGCTCCTGGAAGCGATCGGATTACAGCGGAGGTGCTTTATGCTATGGGTGACTTGGGTGTTATGACTCTATATAAGATCTGCTCACATATATGGCAACACGGTGATTGGCCGCGGGATTGGTTGGAATCCATTATTCTTCCGCTACACAAGAAAGGATCAACCAAGAATTGCGACAATTATCGAACCTTGTCTCTCATCTCACATGCAAGTAAAATCTTGCTTCACATCCTCAACAACCGCATCCGTTACTACCTTGATTGGCAAATTCCGCCAGAGCAAGCGGGTTTCGTGAAGGGCAAGGGTACTCGTGCACAGATTCTCAACATCAGGCAGATTGTTGAGAAAGCATATGAGTTTGACACGCCAGTGATAATGTGTTTCGTCGACTATAGCAAGGCGTTCGACTGTGTCAACTGGAGTTGTTTATGGAAGGTTCTACAAGAACTTGGGGTACCAAATCATCTCATCGCCTTACTTCGCAACTTGTATGGCTCAAGTCAGGCAGTCGTAAGAGTCGATAGAACAACCTCGAAACCTTTTAAATTTCACAAAGGAGTACGCCAAGGTTGTATTTTATCGCCCATTCTTTTCAACGCCTATGGGGAGCACATAATGAGACGGACCTGCGAGAATTGGGACGGTGGCATTACAGTTGGTGGCGTGAAAATCACCAACCTTCGATACGCCGATGATACTACTCTTCTTGCAGCGAATGAGTCGGAAATGGTTGCGCTTCTGGACCGAATGGAGCGGATAAGCAAGGAGATGGGACTTTCCATAAACAGGTCCAAAACCAAAGTCATGGTGGTGGATAGGTCTGGAAAATTGGAACTCACTGGCGCATTAGACCTAGAAATAGTGGACAATTTTAACTACCTGGGTTCCAACATTAGTAACAATGGCTCGTGCGAGAAGGAAGTGCGCCGAAGAATTGGTATGACTAAGAGTGCCATGACTCAGCTCGGAAAAATCTGGAGAGATCGCAACATATCCGTAAAGACCAAAACCAAACTGGTACGGACTCTAGTTTTCTCGATTTTTTCGTATGGCGCTGAGACCTGGTCACTGAAATCTGCAGACCGCAGACGCATTGACGCCTTTGAGATGTGGTGCTGGAGAAAGATGCTGCGTATTCCGTGGACAGCATTTCGGACCAACATATCAATCTTGCAAGAACTCAAAATCTCCTCGCGGCTGTCATCCGAGTGTCTTCGTAGAGTCCTTGAATACTTTGGTCACATCGCACGGAAGGATGGTAGCAATCTCGAGAGGCTCATCGTGACTGGTAAGGTAGATGGGAAAAGACCTCGGGGGCGCAGCCCAATACGTTGGTCCGACCAGATCCGCACCGCTCTTGATTCCACATTTCACAACGCCCTCCACACCGCCAGAGACAAGAATGGATGGAGAAAAATCGTGCGTGCGAAGGTGATACAAAAGGGTGGTCACGACCCTCAGCAATGA
Protein
MESHDISILGISETHMRGNGHFTTVTGNTMYFSGCEDSSLSGVGIILPPHLNKYVLGYNPVSDGILTMKLNTNPCVLNVIQIYAPTAQAQDELIVDFYGKLEEILNSIPSREIKIILGDWNAKVGSTLDDNHIRSTVGKFGLGIRNERGEKLIEFCIERNLSIMNTYFQHHPRRLYTWRSPGDRYRNQIDYIILDGRWRSSVSNVKTFPGAECGSDHNLLVANFSLRLKAPRRQPPKPNSLDPSEQPIFREALEAILKDSPAHIHANADTQWKHLKGHINDALDQIAKKKKPEPKKKCWISDHSWELIQRRKDLKTSGLQDGAKVKYSELSRAIRVSCRLDKNHFVEGICRDIERFSNKLQTADLFKKVRVLSRQFKAKSWVIRDADGTVLHEFDRIAERWRAYCEQLYTDSHSTSGINPEWKDLELEPMILPSEISTALESLKKNKAPGSDRITAEVLYAMGDLGVMTLYKICSHIWQHGDWPRDWLESIILPLHKKGSTKNCDNYRTLSLISHASKILLHILNNRIRYYLDWQIPPEQAGFVKGKGTRAQILNIRQIVEKAYEFDTPVIMCFVDYSKAFDCVNWSCLWKVLQELGVPNHLIALLRNLYGSSQAVVRVDRTTSKPFKFHKGVRQGCILSPILFNAYGEHIMRRTCENWDGGITVGGVKITNLRYADDTTLLAANESEMVALLDRMERISKEMGLSINRSKTKVMVVDRSGKLELTGALDLEIVDNFNYLGSNISNNGSCEKEVRRRIGMTKSAMTQLGKIWRDRNISVKTKTKLVRTLVFSIFSYGAETWSLKSADRRRIDAFEMWCWRKMLRIPWTAFRTNISILQELKISSRLSSECLRRVLEYFGHIARKDGSNLERLIVTGKVDGKRPRGRSPIRWSDQIRTALDSTFHNALHTARDKNGWRKIVRAKVIQKGGHDPQQ

Summary

EMBL
FJ265548    ADI61816.1    FJ265553    ADI61821.1    FJ265557    ADI61825.1    + More
FJ265546    ADI61814.1    FJ265547    ADI61815.1    KZ150025    PZC74827.1    GU815090    ADF18553.1    FJ265560    ADI61828.1    FJ265552    ADI61820.1    BDOT01000017    GCF44634.1    BDOT01000056    GCF48696.1    BDOT01000150    GCF53030.1    BDOT01000018    GCF44752.1    BDOT01000002    GCF40259.1    BDOT01000039    GCF47373.1    BDOT01000077    GCF50202.1    BDOT01000094    GCF51020.1    BDOT01000005    GCF41464.1    GCF40210.1    BDOT01000183    GCF53956.1    BDOT01000049    GCF48208.1    BDOT01000105    GCF51450.1    BDOT01000006    GCF41910.1    BDOT01000101    GCF51279.1    GCF41584.1    GCF53027.1    BDOT01000165    GCF53431.1    GCF44637.1    GCF44732.1    BDOT01000054    GCF48631.1    GCF48632.1    GCF39993.1    BDOT01000008    GCF42705.1    BDOT01000090    GCF50924.1    FJ265559    ADI61827.1    NCKU01003098    RWS08177.1    BDOT01000038    GCF47275.1    GCF51029.1    NCKU01004395    RWS06003.1    BDOT01000045    GCF47814.1    LBMM01007694    KMQ89503.1    NWSH01001998    PCG69477.1    GU815089    ADF18552.1    QIAP01000240    PYX61602.1    AHAT01008485    GBBM01003639    JAC31779.1    AAGJ04118689    AAGJ04161747    KF881086    AIJ27485.1    GGMR01018096    MBY30715.1    KF881087    AIJ27486.1    NEVH01012082    PNF31006.1    NEVH01021219    PNF19787.1    NEVH01020937    PNF20581.1    NEVH01005277    PNF39212.1    NEVH01013959    PNF28275.1    NEVH01002141    PNF42599.1    NEVH01022640    NEVH01008218    NEVH01005885    PNF18513.1    PNF34430.1    PNF38481.1    NEVH01002684    PNF41704.1    NEVH01023985    PNF17546.1    NEVH01017460    PNF24248.1    NEVH01003750    PNF40091.1    NEVH01019064    PNF23230.1    NEVH01014358    PNF27914.1    NEVH01007402    PNF35815.1    NEVH01014359    PNF27789.1    NEVH01013275    PNF29009.1    NEVH01019971    PNF22037.1    NEVH01018372    NEVH01014371    NEVH01011208    NEVH01002697    NEVH01002552    PNF23678.1    PNF27673.1    PNF31697.1    PNF41592.1    PNF42118.1    NEVH01017570    PNF23798.1    NEVH01015309    PNF27009.1    NEVH01025135    PNF15828.1    NEVH01019075    PNF22955.1    NEVH01023960    NEVH01010501    PNF17732.1    PNF32290.1    PNF27813.1    NEVH01017534    PNF24114.1    GDHC01007098    GDHC01001590    JAQ11531.1    JAQ17039.1    NWSH01000469    PCG76200.1    PDHN01000949    PGH37547.1    GFAH01000222    JAV48167.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
PF00168   C2
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
IPR035892   C2_domain_sf       
IPR000008   C2_dom       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
934
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01623
Exp number, first 60 AAs:
0.00284
Total prob of N-in:
0.00015
outside
1  -  934
 
 

Population Genetic Test Statistics

Pi
21.412169
Theta
20.107978
Tajima's D
0.289281
CLR
508.647855
CSRT
0.452477376131193
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号