SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08710
Annotation
Retrotransposable_element_Tf2_155_kDa_protein_type_1_[Papilio_machaon]
Location in the cell
Nuclear   Reliability : 4.248
 

Sequence

CDS
ATGAAATCAATGGCGGATGGAAAAACAAACGTCATATGCATAACTTCCATTGCTACACCAAGTGGACAAGTTTTTGGAATTCCAGTCGAATATCAACCCGTAAATCTTCATAAGGTGATCACAACTACTCCTAACTACACCAGAGTAAAAAACTCTTTAGTAAAAAGGCATCAAACGAGGAAAATATGGATAACTGTGACGGAGGAAATTTCAAAAACATATTTGGATGAAGAACAAAATTTGCAATTCAATGATTGTTATTTGGAAGAGATTTCAGAACAACCTGTTAGTTATGAATCGACATCTAGTGATTCTAATCACATGCTTGAAAAACTGTTAGAAAAACTACAAGAACAAAAACAGCAGAAACCAGAAAAACAAAATTTAGGGAAAATTGCAAAGGATTTTATTATAGAAAAATTCAACGGCCGTAATTCAAATGCATTACAGTGGATCAAAGATTTTAATAAAGAATGTGAACGTTTTCAAATAAACGAGGATAAACAAAAAATTGAAATTTTGAAGAACTTCTTAGAAAATGCTAGTGTAGATTGGTACAGTTGTATGCTGATGAAGCTTACAGTACAATCAGAATGGAGCAAATGGGAGAAAAATTTTTGTGAGACATTTGCGAACAAAGGATGGTCCTCCACTAGATATGCTCTTGCCTTTAAATATCAATCGGGATCCTTACTTGAGTATGCTTTAAAGAAGGAGAAATTATTGTTGGAAGTCAGGAAGACAGTGGATACCGGAACAATTATTGATCTCATAGCATTTGGTTTACCCAATTATGTGGCGGACAAGATTGACAAAGAAACATTACAAAGAACGGAAGACCTTTACAATGAGATAAGAAAATTGGAACATCTGGTGATGAAAAATAAATATGAAAAAAGGAACAGCTCATATAATTTAGATAATAAAGGGAAAAAGATTGACGAAAAGAAACCATGCCCAATCTGTTTAAATGAGAAAAATGGGAAACGGTTCCACCCAGAGGACAGCTGTTGGTTCAAAGAAAAAAATAAAAAAGCTGTGGTTTCTGGAATCTATGACTCTGGATCTAATGTTTCTTTAATTAATGCAAGATTATTGAAAATACAAGAGAAACAGAAGACAAATGATATGCAAGTTGTAAACTTAAAAACTATTAATGGTGAGAAAAAAACGAAAGGTATGGTAACGCTAAAAATAAAAATCTACAATATTGAAAGAAATATGGATATTTTTGTGGTGGATAATGAAAATTTTAACTATGACTTCTTAATTGGTTTGGATTGTATAAAAAAATTCAAATTAATACAAAATGAAGAACTTAACATCATACAATATCCCAAAAAGAAAAGCATAATCTCAAATGAACATTGTTCTAATGAGAATAATGTAACAAATGTCGGAATTCCTAATGTACTAGGTGACAAAAATAAAGAACAAACATTTAAAGAGAGAATAGAAGAGAAAGAGAAGATAGAGATGGAACTATACTCTGAGATAGTAAAAAAGGGTACTACTATAAATACCAACAAATTGTGTGAAATTAATTTCAATGAACATGTAAACATTGATGAATTTCAAATGTCTGTAAATCATCTAGATTTATATCAGCAATCAAAAATTGAGAAGTTAGTAGATAAATACAAATCTGTTTTTGCTAAGGACAAATATGATGTTGGCTCTGTGCAGGATTACGAAGCCCATATAGACTTGATGGTAGATAAATACTGCTATAAGCGTCCGTACAGATGCACAATTGAAGACAGAACAGAAATTGAAAGTCAAATATCGAAGCTACTACAGAAAAATTTGATAGAGGAATCTTACAGCCCGTTTGCTGCTCCTGTAACTCTAGCATATAAGAAAGAAGATGATAAAAAAACAAGATTATGCATAGATTTCAGAGATTTAAACAAAATAGTAGTTCCACAATCACAACCTTTCCCACTTATAGAGGACTTAATGACCAAAACAGTAAACTGTAAGTATTATTCTACATTAGACATAAACTCAGCATTTTGGTCGATCCCATTGAAAATTCAAGATAGACATAAGACTGCTTTTGTGACACAAGAAGGACATTTTCAATGGACTTGTCTCCCATTTGGGTTAAAGACTGCACCAGCGATTTTCCAAAGAATATTGAGCAATATTATAAGAAAACACAGACTATCTAACTTTGCAGTAAACTTTATTGACGACATCTTAATTTTTTCTAAAACTTTTGAGGAACATATACAACACATATCGAGACTACTGGAAGCAATACAAAAGGAAGGGTTTAGACTGAAGTTTTCAAAATGTACATTTGCAAGTCACCATGCTAAATACTTGGGTCATATAATAGAAGACAATTCAGTTAGACCTCTGAAAGATTATTTAACTGCTGTCAAAAGCTTCCCAATTCCAGAAACAAGGAAAAATATACGGCAGTTTTTGGGAAAAGTAAATTTTCATCATAAGTTTGTACCACATAGTGCAATTATCCTCGATCCATTACATAACTTATTAAGGAAAGATGTGAAATTTGTATGGACGGCAGAATGCCAGGAAGCATTTGATAAAATTAGAGCATTGCTTTGCTCAGAACCAATCCTAAAAATATTTGACCCAGATTCACCGATAAGAATTTACACAGATGCTAGTATCAAAGGAGTTGGAGCAGTGTTGAAACAAGACGATGAAAACGGCGTGAGTAAACCGGTTGCTTATTTTTCGAAGAAATTAACAGAAGCACAGAAAAAGAAGAAGGCAATATACTTAGAATGTCTGGCGATAAAAGAAGCAGTCAAATACTGGCAACATTGGCTTATGGGAAAAGAATTTATGGTATACACAGATCATAAACCCCTGGAAAATATGAACATTAAAGCTCGAACTGATGAGGAACTAGGTGATTTAACATATTATCTATCACAATATAATTTTGAAATTAAATACAACCCAGGAAAATCAAATCAAGAAGCGGACTGCTTAAGCCGAAATCCAGTCTTAGAAGCAAATGATAATAACGACGATTTTTTAAAGGTCGTAAATTTAATCGACCTACAAGAAATAAAGAATGACCAGCTAACAAATCCAGACCTACAAAAAGAAAAGAATAAACACATATTAGAGAATGAAGTTTATTACAAGAAAAATAAAAGAAGAAATAAGATTATACTGTCAGAAAAACTTAGCAAAGCTCTAATAAAAAAAGTCCATGACACATACTGCCACATTGGAAGAACCCAGATGACAAATAAAATAACACCATTCTTTTCAGCCAAAAATATTACAGCAAACATTAATAAAATGTGTGATGCGTGTGAAACCTGCATTAAAAACAAGTCCAGGAGGAAGTCGAAATATGGTTTAATGTCACATTTGGGACCAGCCACACACCCGTTTGAAATTGTATCCATCGATACTATTGGGGGCTTTGGAGGATCCCGATCAACCAAAAGTACAGAGAAGGGTATAAATTGGAAGAAGGAGATAGTGTTTATGTGGAGAATGGAAATAAACTAA
Protein
MKSMADGKTNVICITSIATPSGQVFGIPVEYQPVNLHKVITTTPNYTRVKNSLVKRHQTRKIWITVTEEISKTYLDEEQNLQFNDCYLEEISEQPVSYESTSSDSNHMLEKLLEKLQEQKQQKPEKQNLGKIAKDFIIEKFNGRNSNALQWIKDFNKECERFQINEDKQKIEILKNFLENASVDWYSCMLMKLTVQSEWSKWEKNFCETFANKGWSSTRYALAFKYQSGSLLEYALKKEKLLLEVRKTVDTGTIIDLIAFGLPNYVADKIDKETLQRTEDLYNEIRKLEHLVMKNKYEKRNSSYNLDNKGKKIDEKKPCPICLNEKNGKRFHPEDSCWFKEKNKKAVVSGIYDSGSNVSLINARLLKIQEKQKTNDMQVVNLKTINGEKKTKGMVTLKIKIYNIERNMDIFVVDNENFNYDFLIGLDCIKKFKLIQNEELNIIQYPKKKSIISNEHCSNENNVTNVGIPNVLGDKNKEQTFKERIEEKEKIEMELYSEIVKKGTTINTNKLCEINFNEHVNIDEFQMSVNHLDLYQQSKIEKLVDKYKSVFAKDKYDVGSVQDYEAHIDLMVDKYCYKRPYRCTIEDRTEIESQISKLLQKNLIEESYSPFAAPVTLAYKKEDDKKTRLCIDFRDLNKIVVPQSQPFPLIEDLMTKTVNCKYYSTLDINSAFWSIPLKIQDRHKTAFVTQEGHFQWTCLPFGLKTAPAIFQRILSNIIRKHRLSNFAVNFIDDILIFSKTFEEHIQHISRLLEAIQKEGFRLKFSKCTFASHHAKYLGHIIEDNSVRPLKDYLTAVKSFPIPETRKNIRQFLGKVNFHHKFVPHSAIILDPLHNLLRKDVKFVWTAECQEAFDKIRALLCSEPILKIFDPDSPIRIYTDASIKGVGAVLKQDDENGVSKPVAYFSKKLTEAQKKKKAIYLECLAIKEAVKYWQHWLMGKEFMVYTDHKPLENMNIKARTDEELGDLTYYLSQYNFEIKYNPGKSNQEADCLSRNPVLEANDNNDDFLKVVNLIDLQEIKNDQLTNPDLQKEKNKHILENEVYYKKNKRRNKIILSEKLSKALIKKVHDTYCHIGRTQMTNKITPFFSAKNITANINKMCDACETCIKNKSRRKSKYGLMSHLGPATHPFEIVSIDTIGGFGGSRSTKSTEKGINWKKEIVFMWRMEIN

Summary

Pfam
PF17919   RT_RNaseH_2        + More
PF17921   Integrase_H2C2
PF00078   RVT_1
PF00665   rve
PF00098   zf-CCHC
Interpro
IPR041577   RT_RNaseH_2        + More
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.8864e-70,     Score=680

Ontologies

Topology

Length:
1168
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.403250000000001
Exp number, first 60 AAs:
0.39311
Total prob of N-in:
0.01865
outside
1  -  1168
 
 

Population Genetic Test Statistics

Pi
195.207
Theta
163.874552
Tajima's D
0.506497
CLR
0.032822
CSRT
0.51812409379531
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号