SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08700
Pre Gene Modal
BGIBMGA005007
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.474
 

Sequence

CDS
ATGATGATGGCCAATTGTGAAAAGTTAGTACCCCAGGAGGGTACCGCCTGCGAGTCGGGCGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCACGCTGCCCCACGTATTCTGGGGGGGGCAACAATTGCCAAGATGAAGGAGGCTGTGCGACGGGCAGCGGAATTCCCGTCGAACCGATGCGCTCCCTGATCGCCGGCTCGATGCGCTCTGCGCTCGCCAGCGAATCGGTTGCGATGAACCCCACCAAACCATCGGCGGGGAAAAAGAGGGGCCGAAGGAAGATCCCCGTAGCAGCTTCCGACGACGGCGGTGCGTCATCCTCCAGCACCGAGGTGCCGGAAAAGACCATGGCCGTCGAGGAGGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGATACGATGCCCGCACCCCAGTGGGCACCAGTGAGGAGGAGGGGCGCAGTGTCACCGGCGACGTCGATGGAGTCGATGTCGACGTCGGCCGCGTCCCTGGCTAGCGGGGACGAGGCATTCCGCGACCTCGACCATGCCCTGGTCAATCTGGCTAAGTTGCTGTCGACCGTGGCTGCCAAGGGCGCCGAGCCAGGCAGCAGCTACCGGAAGAGGCTCCGGGAGGGAGCCGCTAGGGTTAGGACGAAGCTGATCCCTACCATGTCCAAACTCGTAGCGCAGCTTGACTCCAGGGAGAGTCGCATTCTGGGGGGCTCCCCAGCCTTGCGAGAGGGGACTTCCTTGTCGCCGATGCCTGCGCTGGCACGCTCTGAGCCACCCGTGAGGAAGATGGACACCAGCGCGCCTTCTCGGGCTGGGATGAGTGTGGCGGCGCTCATGCCAGCGCCCACTTCTGTTCCGCGCGTGCCTACTCCCGCGCTCCCTCGCCCCCCTCGGAGGGTTGAGTTAAGGCCTGCGCCGCCTTCCCGGATATCGGCCGCCCCTGCATCCATACAGGCAGGAAGGTTAAGGACTGAGGACATCCGCTCGCCGCTGGCGAGAATGGTAGACGAGTGGCCGGCGCTGCCACGGCCCAGGTCTTCGGAGCCGCCTCTTTCGCCCCCACGTGCTGCAGGGTCGCAGAGGCCTTATAACATGGCTGCTGAAATGGGGGGAGTGGATCACTCCCTCCCAAGCAGACAGGAAATGATGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAACACTTGGCTGGCCTTGAGGAGATGCTCCGCTCCTCGATTGGTTCCAGAGACTGCGTCCCTGTACCAACAGCGGCGACCGCCCCGCGGGACCAGGCCACCCAGCCGACCTCCACTTCTACCCCATCCGCGAGGGTGGCACGACATGGAAGCCGGAATCAGCATAACAGAGGTGCGGGCGCCCAGAATCCCGCCCCGCGATTCCAACCTCAGCCCCGTGTCCTTCCTCCCCCCCCGTCAAGTATGGACGAGGGCTGGACGGAAGTGGTGAAGCGGGGCACCAAAAGATTGCGACAGACAGCAGCTCTGGCAGCTCCCCAAGGGGGTCGAGCGCCGACTGCTGTTACCCGAAACACAGCGCTGGCGGCCGTGGCTGCTCCCCGCGAGGGTCGAGCACCGGCCGCTAGCAAGACCAAAAACAAGAAGAAGAAGCCGCGCGCAGCGGGGTCGGCTGCCGTTGTAGTGACGTTGCTGCCGGCCGCCATCGAAAAGGGCCTCACGTATAATGAGGTTATGGCCCGGGCGCGCGCGGCCGTAAGCTTGGAAGAAATCGGAGCAGAGGAGGGCCTCCGCTTCCGGCACACAGCCAATGGGGCGAAGCTATTGGAGTGTCCCGGTGCCGATAGTTCTGGCATCGCGGACAAACTAGTGGCGACGCTCCGCGTGGCGTTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGTTGAGGATGGCCGAGATTAGGATCACCGGCCTAGACGACTGCGCCACCAAGGAGGAGGTGGCAGCTGCGATAGCGGCCCAGGGGAGATGTGCCCCAGAGAGCGTGACCGTGGGCGAACTTCGCTCAGGGTACTCCGGGGCCAGGTCAGCGTGGGCGCGCTGCCCTGTGGAGGCGGCCATTTCCTTGGCCACTCCTCCACCGGGAAGATCGACGGGGGATCCGGGGAGACTGCGCGTGGGCTGGATAGCGGCCCACGTGCGTCTCCAAGAACCACGTGCCTGGCGATGCCTTCGGTGCTTCAGCACGGGGCACGGACTCGCTAGGTGCACCAGCTCGGTTGACCGCAGCGGTTTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCTGCGTCCTGCACGGCCGCCCCGCATTGCGCTCTGTGCGCTGCAGCCGGACGCAGGGCAAACCACCGGGCGGGAGGCAAGGCGTGTTTCCCGTCCGGTAATAATACCGAACGCAACCGGCGCCGAAAATCGAAGCGCCGGCAAAAGAGAAGGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCTGGTGCCGAAGGGCGGTGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCAGCAAATGATTGCTGGTTTGGGGACGACGGCGGCCTGGCGGCCATCGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGTCAAGGGTTCGTCGCGGTGCAGCTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGTCTACCGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCTCGTCCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTATCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGATCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCGGCCATCGCGCGCCGTATCCGCGACTGGAGGGTTTTGGAGGGGGCGGAGACGTTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGCCCTCGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTTCGGGACACGATGCGTCGCATCTGTGATGTGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAAATCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCAGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGCCGCATTTCGCGTCGCGCAGAGGGCACTGCAGCTGGCCATCAGAAGAGCCAAGGATCAACACATGGAGGGTCTCCTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCTCCGATCACGGAGCGTCTCCAGCCTCAAAAGCTGCGGGACATCGTCTCGACGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACTCGCCGCCGGAATACGACGGCGAAGTCCCTGCCGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAGGACACTGCACCCGGTCCGGACGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTGGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGATGAGGCCGTTTCCGGGGGTGGGGTGGCTTTGGCGGTGTCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCGTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGGGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGAGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTTGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGTCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCTAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTTCTTGTGAACTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGTGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAGGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MMMANCEKLVPQEGTACESGGESLRASTSVEARCPTYSGGGNNCQDEGGCATGSGIPVEPMRSLIAGSMRSALASESVAMNPTKPSAGKKRGRRKIPVAASDDGGASSSSTEVPEKTMAVEEVAPVISGPAASKDTMPAPQWAPVRRRGAVSPATSMESMSTSAASLASGDEAFRDLDHALVNLAKLLSTVAAKGAEPGSSYRKRLREGAARVRTKLIPTMSKLVAQLDSRESRILGGSPALREGTSLSPMPALARSEPPVRKMDTSAPSRAGMSVAALMPAPTSVPRVPTPALPRPPRRVELRPAPPSRISAAPASIQAGRLRTEDIRSPLARMVDEWPALPRPRSSEPPLSPPRAAGSQRPYNMAAEMGGVDHSLPSRQEMMACISRAVAVEVGKHLAGLEEMLRSSIGSRDCVPVPTAATAPRDQATQPTSTSTPSARVARHGSRNQHNRGAGAQNPAPRFQPQPRVLPPPPSSMDEGWTEVVKRGTKRLRQTAALAAPQGGRAPTAVTRNTALAAVAAPREGRAPAASKTKNKKKKPRAAGSAAVVVTLLPAAIEKGLTYNEVMARARAAVSLEEIGAEEGLRFRHTANGAKLLECPGADSSGIADKLVATLRVALPEEEVRVHRPLRMAEIRITGLDDCATKEEVAAAIAAQGRCAPESVTVGELRSGYSGARSAWARCPVEAAISLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCAAAGRRANHRAGGKACFPSGNNTERNRRRKSKRRQKRRLARGALANAVIPAAALVPKGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRSTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSIAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADALGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDVSMPRIGPRLPNRQAYWWSPEIAQIRVECVRARRECARHRRRRLPRRNDPVAFAAAEARLHAAFRVAQRALQLAIRRAKDQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQKLRDIVSTLFPQEREGFVAPAMDSPPEYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSDEAVSGGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHGGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRVRGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVNWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=8.4294e-10,     Score=159

Ontologies

Topology

Length:
1883
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18799
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00050
outside
1  -  1883
 
 

Population Genetic Test Statistics

Pi
234.152077
Theta
115.71539
Tajima's D
1.436259
CLR
247.132934
CSRT
0.772761361931903
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号