SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08681
Pre Gene Modal
BGIBMGA007650
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like_[Papilio_xuthus]
Full name
PiggyBac transposable element-derived protein 3       + More
Chimeric ERCC6-PGBD3 protein      
PiggyBac transposable element-derived protein 2      
Alternative Name
Chimeric CSB-PGBD3 protein
Location in the cell
Nuclear   Reliability : 4.12
 

Sequence

CDS
ATGGCAAATGACAGACCGTTAGCTGCGCATGAAATTTTAGATGCTTTAGAAAATGTTTCTGATAATGAAGAAGATTATAGAGAACGACTGATATGTATTCTACCTCCTCCTGTTGATCCTGACTGTCTCACTGACGAAGATTCGGGTGAAGAAGATAATGTAACTTTGAATAATTTGCCACGAAACATTCTGCTTCAACCGGCTGAAGTAATGATTCAAGGGCAGATTATGGTGAGTGATACAGAAGAAGAACCTTCTGATTCTACAGGTCGAACTAAACGTAGGCGTACCTACGCATGGAGAAAACGGGACTTGGCAAAAAAACCCGTGAATTGGCCAGATGTTCAAGGCGCTTGCCAAGATAAGCGCCCAATTGAGTGGTTTGAAAACTTCTTAGATGAAGATGTTATTTCGTTGTTGGTGTCAGAGAGCAATAAATATGCTGTCAAAAAGAATTTGCCTGGAGACATAACCACTGAAGATATGAAATGTTTCATCGGCATATTGTTGGTTAGTGGTTATTCATGGCTCCCCCGTAGAAGAATGTATTGGGAAAACTCCCCTGATACAAAGAATGAATTGATCAGCTCGGCTATGACTAGGGATAGATTTGACTTTATTTTTCGCCACCTTCATGTCAATGATAATCTGGATTTGCAAGACAAATACACAAAAGTACGCCCCCTAGTTACACTTCTAAATAAAAAGTTCTTAGAGTTTTCTCCTCTTGAAGAGCATTACGGTGTAGATGAGGCCATGATCCCCTACATGGCTGCAAACAGCACATAA
Protein
MANDRPLAAHEILDALENVSDNEEDYRERLICILPPPVDPDCLTDEDSGEEDNVTLNNLPRNILLQPAEVMIQGQIMVSDTEEEPSDSTGRTKRRRTYAWRKRDLAKKPVNWPDVQGACQDKRPIEWFENFLDEDVISLLVSESNKYAVKKNLPGDITTEDMKCFIGILLVSGYSWLPRRRMYWENSPDTKNELISSAMTRDRFDFIFRHLHVNDNLDLQDKYTKVRPLVTLLNKKFLEFSPLEEHYGVDEAMIPYMAANST

Summary

Description
Binds in vitro to PGBD3-related transposable elements, called MER85s; these non-autonomous 140 bp elements are characterized by the presence of PGBD3 terminal inverted repeats and the absence of internal transposase ORF.
Involved in repair of DNA damage following UV irradiation, acting either in the absence of ERCC6 or synergistically with ERCC6. Involved in the regulation of gene expression. In the absence of ERCC6, induces the expression of genes characteristic of interferon-like antiviral responses. This response is almost completely suppressed in the presence of ERCC6. In the presence of ERCC6, regulates the expression of genes involved in metabolism regulation, including IGFBP5 and IGFBP7. In vitro binds to PGBD3-related transposable elements, called MER85s; these non-autonomous 140 bp elements are characterized by the presence of PGBD3 terminal inverted repeats and the absence of internal transposase ORF.
Miscellaneous
PGBD3 gene is located within ERCC6 intron 5.
Keywords
Alternative splicing   Complete proteome   DNA-binding   Nucleus   Phosphoprotein   Polymorphism   Reference proteome   Disease mutation   Isopeptide bond   Premature ovarian failure   Ubl conjugation  
Feature
chain  PiggyBac transposable element-derived protein 3
sequence variant  In dbSNP:rs4253072.
splice variant  In isoform 2.
EMBL
AGBW02008302    OWR53786.1    RSAL01000353    RVE42252.1    JX294476    AGK25052.1    + More
BABH01003188    BABH01003189    GECU01036039    JAS71667.1    GEZM01060808    GEZM01060807    JAV70895.1    DS497727    EFA12977.1    GECU01021786    JAS85920.1    HAAD01002582    CDG68814.1    GAMP01000187    JAB52568.1    GAMT01003553    GAMT01003551    GAMQ01002282    JAB08308.1    JAB39569.1    GAMR01006104    JAB27828.1    GAMS01002010    JAB21126.1    AEFK01164926    AEFK01164927    JSUE03043349    JU470545    AFH27349.1    GEGO01007284    JAR88120.1    NDHI03003654    PNJ11666.1    AK074682    AL138760    BC028954    BC063690    NBAG03000461    PNI21937.1    AQIA01070964    GABF01001690    JAA20455.1    AHZZ02035229    AEYP01099555    AEYP01099556    AB179012    BAE02063.1    PNJ11664.1    PNJ11665.1    ADFV01105741    ADFV01105742    ADFV01105743    ADFV01105744    ADFV01105745    CABD030070918    GAMT01004683    GAMP01007477    JAB07178.1    JAB45278.1    BC034479    AK291018    CH471187    BAF83707.1    EAW93095.1    AACZ04060518    PNI21935.1    PNI21936.1    CYRY02043934    VCX38622.1    LWLT01000008    KB017432    EPY77693.1    AMGL01092670    GECU01010197    JAS97509.1    MKHE01000009    OWK12058.1    GECU01009093    JAS98613.1    AANG04001781    UFQT01000583    SSX25489.1    AAQR03188110    AACZ04070590    GABC01008499    GABE01003522    JAA02839.1    JAA41217.1    GABZ01005161    JAA48364.1    NDHI03003683    PNJ08718.1    AK123219    BX647065    AL672183    CH471257    BC063785    ABGA01061445    ABGA01061446    ABGA01061447    ADFV01037738    ADFV01037739    ADFV01037740    ADFV01037741    ADFV01037742    AK298248    BAG60513.1    JH880825    ELR58540.1    CABD030010211    CABD030010212    CABD030010213    GABF01004510    GABD01006865    NBAG03000628    JAA17635.1    JAA26235.1    PNI12914.1    AGTP01101535    AGTP01101536    AHZZ02018138   
Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

Topology

Subcellular location
Nucleus  
Length:
262
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.06178
Exp number, first 60 AAs:
0
Total prob of N-in:
0.05217
outside
1  -  262
 
 

Population Genetic Test Statistics

Pi
245.257978
Theta
132.725268
Tajima's D
2.785913
CLR
0.335422
CSRT
0.966801659917004
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号