SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08676
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Amyelois_transitella]
Location in the cell
Extracellular   Reliability : 1.414 PlasmaMembrane   Reliability : 1.656
 

Sequence

CDS
ATGAATAGCAGCGGTTCTATTTATAATATAGTTAGTTTCAACTGCAAAGGAGTGAAACGATCCGTGGAACATGTAAGACAGCTGTGTCGGACGTCGGATATAATCGCGTTACAAGAGACGTGGTTATTGCCGGACGATTTACAGTTTCTCAGTGCCATTGATAGCGAATATGGCTGCACCGGGACTTCGGCCGTAGATACTGCGGCCGGGATACTCAGGGGGCGTCCATACGGAGGAGTGGCGCTACTATGGAAGAAAAGTATCTTTCAAAATGTGTCGATAGTGCAGTGTGATAACGCGCGTGTGTGTGCTATAAAAGTAACAATAGATCAGAGATCGTTATTGGTGTTCAGTATTTATATGCCTACGGATAATGCAGTGAACCTAACGGAGTTCATGGATTGCCTCAGCCTGATGAGCGCTATTATTAGTAACGAAAATATCGAATCAGTGTATATACTCGGCGATTTTAACGCCCATCCTAATGAACCTTTCTACAGGGAGTTGGCATGTGTCTGTGGGGAATTAGGATGGACTTGTGCGGACGTTGAACTATTAGGTGTAAATTCAGACACGTATAGTTTTATTAGTGAGGCGAATGGGTCCAGACGTTGGCTGGACCACTGTGTAGTCACGAAGTCAGCTATGCAGACCATTGTCAATACGTATATACTGTATGATGTCTTGTGGTCTGACCACTTTCCAGTAGTAGCACAGTGTGATTTTAACACTATAAAACCGAAATTTAATAATGTTACTCAATTGTGTAGTACTGTGCGATGGGGGGACAGAAAACCTGAGCAAATTGAATTTTATCATAAGATATGTCATGATAAACTGAGACAGATAGATTTTCCTGGCATTCTAAGTGATTGTTGTGATTGTGTTTGTAGTAATTCTGACCACAGACACATTTTAGATAAAATGTATCATGATATTGTTGACGTACTATGTCAAGCGGCTAGCGACAGTTATTCCCGTAGCAGATTTAATTGTAAAAAACCTGTTATTGGCTGGAATCGATATGTTAGTGATGCTCACGGGGAGGCGAGGTGTAAGTTTATTCTATGGGTGTGGCATGGTAAGCCGAGGTCGGGTCGTGTTTGGAAAGAAATGCAAGAGAGTAGGAAAATTTTTAAATCACGTCTGAAATGGTGTCAAAACCACAGCGAGCAGTTAAGAATGGATATACTCGCGTCTCATCACTCCAAGCACGATTTTCACAGCTTCTGGAAATCTACCACTAAACTTAATGGTAAACCAGGCCTGCCCGTGAGCGTCGGTGGTATAAGTGATCACGATGGCATCACGAATATGTTTAGGGAACACTTTGCGGTTAGTTCGCCATTGGGACCATCACAGTCAGGGTGTGTGGGTGATTCTCAGGGGCGGATAGTTACTGCTAGGTTTACGGCTAACGAAGTTAGAAAAGTTATTAACTCCATGTCACGGGGTAAGTCTCCGGGTCATGACGAGCTGAGCATAGAACACCTAAAGTATGCCGGTGTACACTTGCCCCGAGTCTTGGTTATGTTCTACAATTTATGTATAGGACACTCCTACTTGCCTGAGGAGATGTTGAAGACTGTGGTAGTGCCAATTGTGAAGAATAGGACCGGGGATATATGTGATAAAACCAATTACAGACCCATCTCGTTAGCAACTATCATAGCGAAAGTGCTTGACAGTTTGCTTAATATACAACTTGATAAATATCTTCAGATACATGATAACCAGTTTGGTTTTAAATCAGGAATGTCTACAGAAATAGCCGTATTGTGTTTAAAGCAAACTGTCAAGTACTATACTGATCGAAAAACTCCAATTTTTGCCTGTTTCCTCGATTTATCAAAGGCATTCGACCTGGTTTGTTATGACATCTTATGGCAAAAACTGAATAATACTAAAATGCCGAAAGAACTAGTACAGATATTCAAATATTGGTACGCCAACCAGCTGAACGTGGTACGATGGTCGGGTGTCTATTCGAGGCCATACGGGATGGAGTGCGGGGTGAGGCAAGGGGGGTTGACCTCGCCCAAGCTCTTCAACCTGTATGTGAATGCTCTAATCGAGGAGCTCAGCAGTACTCATGTCGGCTGCCATATTGATGAAATATGTCTCAACAATATCAGTTATGCTGATGACATGGTGCTGCTGAGTGCGTCGGCCTGTGGGCTGTCTAAGCTGCTTGGCATATGTGAAAGGTATGCTCTAAGTCACGGTCTGGTGTATAATACAAAGAAAAGTGAGTGTATGGTGTTTCAGGCCAGAGGCAGGTGTCTGGATAACATTCCCTCCGTCAAACTGAATGGTACGCCACTGCGCAGAGTAGACAAGTTTAAATACCTAGGACACTTTGTAACCTCTGACCTGAGGGATGATACAGACATTGAGCGGGAGCGGAGAGCGCTGTCTCCTGTGGGTGTTCTATAG
Protein
MNSSGSIYNIVSFNCKGVKRSVEHVRQLCRTSDIIALQETWLLPDDLQFLSAIDSEYGCTGTSAVDTAAGILRGRPYGGVALLWKKSIFQNVSIVQCDNARVCAIKVTIDQRSLLVFSIYMPTDNAVNLTEFMDCLSLMSAIISNENIESVYILGDFNAHPNEPFYRELACVCGELGWTCADVELLGVNSDTYSFISEANGSRRWLDHCVVTKSAMQTIVNTYILYDVLWSDHFPVVAQCDFNTIKPKFNNVTQLCSTVRWGDRKPEQIEFYHKICHDKLRQIDFPGILSDCCDCVCSNSDHRHILDKMYHDIVDVLCQAASDSYSRSRFNCKKPVIGWNRYVSDAHGEARCKFILWVWHGKPRSGRVWKEMQESRKIFKSRLKWCQNHSEQLRMDILASHHSKHDFHSFWKSTTKLNGKPGLPVSVGGISDHDGITNMFREHFAVSSPLGPSQSGCVGDSQGRIVTARFTANEVRKVINSMSRGKSPGHDELSIEHLKYAGVHLPRVLVMFYNLCIGHSYLPEEMLKTVVVPIVKNRTGDICDKTNYRPISLATIIAKVLDSLLNIQLDKYLQIHDNQFGFKSGMSTEIAVLCLKQTVKYYTDRKTPIFACFLDLSKAFDLVCYDILWQKLNNTKMPKELVQIFKYWYANQLNVVRWSGVYSRPYGMECGVRQGGLTSPKLFNLYVNALIEELSSTHVGCHIDEICLNNISYADDMVLLSASACGLSKLLGICERYALSHGLVYNTKKSECMVFQARGRCLDNIPSVKLNGTPLRRVDKFKYLGHFVTSDLRDDTDIERERRALSPVGVL

Summary

Similarity
Belongs to the peptidase S1 family.
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
PF00089   Trypsin
PF00057   Ldl_recept_a
PF03372   Exo_endo_phos
PF01392   Fz
Interpro
IPR024989   MFS_assoc_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036259   MFS_trans_sf       
IPR000477   RT_dom       
IPR020846   MFS_dom       
IPR033116   TRYPSIN_SER       
IPR036790   Frizzled_dom_sf       
IPR020067   Frizzled_dom       
IPR009003   Peptidase_S1_PA       
IPR001314   Peptidase_S1A       
IPR001190   SRCR       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
IPR036055   LDL_receptor-like_sf       
IPR002172   LDrepeatLR_classA_rpt       
SUPFAM
SSF103473   SSF103473        + More
SSF56219   SSF56219       
SSF50494   SSF50494       
SSF57424   SSF57424       
SSF63501   SSF63501       
Gene 3D
PDB
5HHL     E-value=0.00102315,     Score=103

Ontologies

Topology

Length:
811
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.03178
Exp number, first 60 AAs:
3e-05
Total prob of N-in:
0.00062
outside
1  -  811
 
 

Population Genetic Test Statistics

Pi
37.160711
Theta
49.292578
Tajima's D
-0.716282
CLR
242.308164
CSRT
0.198890055497225
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号