SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08623
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.672
 

Sequence

CDS
ATGAAGCCTGCAAAGGTTTTCAAAAACATCGCCAACGCGTTCAACACCTTGCCCTGGTCGGTGATCGCAGGGGCGCTGGAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGACAGGTCGGTCGTGTGCACCGGGCACGGTGGGGCGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCTTGCGTGGCGCCCTAAGCACTCCTCTCCCGGGTCTGAGCGTAGTTTGCTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCATCATCGGCAGGATCCGAAGGCTGGGTCTGGAGGTGGCGCTCGATAAATCCCAGGCCCTGTTGTTTCACGGGGCTCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCGACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTCCGCGCTCACTTTGAGAGATTAGGTCCCCGACTGATGGCGGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACTTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACATTGCGGCGTTGCGACGTCCGCAGCGCGCGATTGCGGTCAGGGTGGTTCGTGGATACCGCACCGTCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGCCGCGTCCTGGCGCGGCGGAAGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTGCACCTCGTCGCCCGGAGGGAGCCGACTCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCCCCACTGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTCGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAAGCGGCGGAAGGGAGAGCTCTTCTTCCCTCTCGGCGCCGTGCCGCCGCCGTCGGGCCGAGGGCCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGAGGAGGCAGTCTCCTCCCGCGCGCTGGCACCAGGAGAACGGGACGGCGCGTCGGCGGCTGCGGACTGCGATGCGGTCCGCATTTTCGTCGTCGCTGTCGTCGCCGAACATACTGTTGAAGAGCAACCCGGTCGGCGGTGTATCGCGTTCCGACCCGGCAGGCTGGTTCTGGCCCAGCGGGGTATCCCGGAACACCAGCGGCACCGCCCGGGCGGCCTGGTAGGGCCGCCGTACCGCGGAGACTGA
Protein
MKPAKVFKNIANAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEDRSVVCTGHGGAVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRGALSTPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFIIGRIRRLGLEVALDKSQALLFHGARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDLVVRRLYTGVVRSMALYGAPVWCHALTRDNIAALRRPQRAIAVRVVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEPRPGAAEVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCPTVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTISQKEAAEGRALLPSRRRAAAVGPRAGGGRLSSSSPYEEAVSSRALAPGERDGASAAADCDAVRIFVVAVVAEHTVEEQPGRRCIAFRPGRLVLAQRGIPEHQRHRPGGLVGPPYRGD

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
511
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.96775000000001
Exp number, first 60 AAs:
2.91983
Total prob of N-in:
0.13969
outside
1  -  511
 
 

Population Genetic Test Statistics

Pi
0.204735
Theta
1.857583
Tajima's D
-2.064798
CLR
14.428757
CSRT
0.00419979001049947
Interpretation
Possibly Positive selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号