SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08570
Annotation
unnamed_protein_product_[Tribolium_castaneum]
Location in the cell
Cytoplasmic   Reliability : 1.489 Mitochondrial   Reliability : 1.806
 

Sequence

CDS
ATGGGCATGGCACAAATTCAAAGCATAGCTGATGGCCTCTTCCCGGAACACATAGATTTCGAACGGAAAACGAAACCGTCACAGGAGTTCCCAGAGGTGACCGAGGAGGAGATCATCCAACTAAAAGCTCGCATAAAGCTCAGGAAAGCCCCAGGGCCCGACCGGATTCCGCCGGAGATAGTGACTCTAGCAGTAGCAGTAATTCCAGACAGGATAAGGCTTGTGTTGCAGAAGGTGCTGGAGTCTGGCGTCTTCCCCAACAGCTGGAAAACAGCCAGACTAGTCCTGCTAAGAAAACCAGGCAAACCCGCTGAAGATCCTGCGGGGCACAGGCCGCTATGTCTACTGGACTGCTACGGAAAGCTGCTGGAGTCGCTGATCCTAGGCAGAATAGAAAAAACAACTACCAACAAGCTACTTGAGATAGCGGAAGACGCGAGACGAGGAACCCACCGCACCAGAAGAATCTGCGCAGTAGTGGCCCTCGACGTCCGTAATGCTTTCAATTCTGCATCGTGGGAGCTCATCCTGGAGGAAATGGCTGCAATAGGTATGCCTCAATACATCTATAATATCATAAACAGCTACCTCCAGGACAGATGCATCATACTGACAGACGCTGAGGGAGGGGTTGTAGTGAAAAAGGTTACCGGTGGTGTTCCGCAGGGGTCGATACTGGGCCCCACGCTGTGGAACATACTGTATGATGGGGTACTGCGCCTCGAACTGGGGGATGGGGCACAATTAATAGGCTTCGCGGACGATTTAGCTCTGGTGGTGTCAGCAAAGAAGGAAGCAGAACTAATGGCAATAACGAATGTAGCCCTACAAAAGATCAGCGCTTGGATGAAGCAAAAGCGGCTACACTTGGCCCCAGAAAAGACCGAGGCAATTGTGCTAAGTGGGCGAAGAAAGCTTAGCGAGATTTGCTTTACCCTCCAGGGCGTCAGGGTGGTTCCAACCGACAAACTGAAATACCTCGGGTTTTGGTTTGACAAAAGTCTGAAGTTCGGCAAACACATTGAAGAAACAACTGGTAAAGCCGAAAGACTGACGACCGCCCTTGGCCAAATCATGCCCAGGAAAGGAGGGCCGAGGTCGAGCAAGCGCAGACTATTGGCGTCCGCAATACAATCTGTGATGTTATATGGAGCACCGGTGTGGGCAAAGGTAATGAATGTAGCGAAGTACAGGAACATGTATAGCAAAGTGCCAACGACAGCTGGCAATACGCATCTGTGGAGCTTACCGTACCATATCGCTAGACGCCGTCTTGGTGATAGCGGGCCTGATACCGATAGAACGGCTAGCAAAGGAACCGGCAACGCTACTACCACGAGGGGACAAGAACGAGAGAAGAGGAAAGAGCACATACAATAA
Protein
MGMAQIQSIADGLFPEHIDFERKTKPSQEFPEVTEEEIIQLKARIKLRKAPGPDRIPPEIVTLAVAVIPDRIRLVLQKVLESGVFPNSWKTARLVLLRKPGKPAEDPAGHRPLCLLDCYGKLLESLILGRIEKTTTNKLLEIAEDARRGTHRTRRICAVVALDVRNAFNSASWELILEEMAAIGMPQYIYNIINSYLQDRCIILTDAEGGVVVKKVTGGVPQGSILGPTLWNILYDGVLRLELGDGAQLIGFADDLALVVSAKKEAELMAITNVALQKISAWMKQKRLHLAPEKTEAIVLSGRRKLSEICFTLQGVRVVPTDKLKYLGFWFDKSLKFGKHIEETTGKAERLTTALGQIMPRKGGPRSSKRRLLASAIQSVMLYGAPVWAKVMNVAKYRNMYSKVPTTAGNTHLWSLPYHIARRRLGDSGPDTDRTASKGTGNATTTRGQEREKRKEHIQ

Summary

EMBL
GEBQ01030504    JAT09473.1    AB593325    BAK38646.1    KQ972160    EFA13619.2    + More
GEHC01000964    JAV46681.1    KQ973343    KXZ75566.1    AB593321    BAK38639.1    GALX01005145    JAB63321.1    KQ971388    KYB24913.1    KQ971310    KYB29499.1    KYB29500.1    KU543683    AMS38371.1    KQ972691    KXZ75806.1    GALA01001777    JAA93075.1    GALA01000302    JAA94550.1    KQ972544    KXZ75869.1    GALA01001776    JAA93076.1    KXZ75807.1    KQ972226    KYB24577.1    KQ971309    EEZ99146.1    GDAI01000741    JAI16862.1    ABLF02041557    GAMC01019173    JAB87382.1    GGFL01001916    MBW66094.1    ABLF02041886    GALX01002229    JAB66237.1    GGMR01000779    MBY13398.1    GFXV01003903    MBW15708.1    GEHC01000915    JAV46730.1    ABLF02021100    GGFL01004044    MBW68222.1    GAPW01000192    JAC13406.1    ABLF02009073    ABLF02030702    ABLF02042963    GGFK01006563    MBW39884.1    AB593324    BAK38644.1    APGK01005465    KB736249    ENN83233.1    HACL01000281    CFW94575.1    GGFK01006866    MBW40187.1    GGFK01005660    MBW38981.1    AB593323    BAK38643.1    ABLF02027248    GAMC01020519    GAMC01020515    JAB86040.1    GAMC01020517    JAB86038.1    GAKP01002292    JAC56660.1    GALX01004785    JAB63681.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    KB630188    ERL83462.1    GGFJ01001727    MBW50868.1    GGFJ01001370    MBW50511.1    GGFL01001583    MBW65761.1    GGFJ01001369    MBW50510.1    ABLF02034925    KXZ75870.1    GGMR01008673    MBY21292.1    KU543679    AMS38363.1    ABLF02004920    ABLF02004921    ABLF02015191    ABLF02016615    ABLF02024214    GBRD01017378    JAG48449.1    GGFJ01001439    MBW50580.1    ABLF02021645    GGMR01011682    MBY24301.1    M93691    AAA29365.1    AAZX01001144    GGMR01019493    MBY32112.1    ABLF02016340    AB090815    BAC57906.1    AB090817    BAC57910.1    GGFJ01001541    MBW50682.1    APGK01033685    KB740885    ENN78512.1    GGFL01001456    MBW65634.1    AB090812    BAC57900.1    GFTR01008427    JAW07999.1    ABLF02023257    GGFL01004046    MBW68224.1    ABLF02030663    ABLF02041312    GGFL01004047    MBW68225.1    KQ972255    KYB24568.1    GGFM01001733    MBW22484.1    GFXV01002090    MBW13895.1    ABLF02020562    ABLF02011183    ABLF02041884    KQ973256    KXZ75595.1    GGFM01001554    MBW22305.1    AB593327    BAK38648.1    GGFJ01001164    MBW50305.1    GGFJ01001165    MBW50306.1    ABLF02018942    ABLF02041885    AJ278684    CAB99192.1    ABLF02014650    GGFK01007771    MBW41092.1    KU543682    AMS38369.1    GGFJ01001453    MBW50594.1    ABLF02005203    ABLF02041316    ABLF02009709    ABLF02009711    AB593322    BAK38641.1    GGFL01001189    MBW65367.1    GGFJ01001454    MBW50595.1    GGFL01001190    MBW65368.1    GALX01004171    JAB64295.1    GGFL01001192    MBW65370.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF00098   zf-CCHC
PF13966   zf-RVT
PF00075   RNase_H
PF12017   Tnp_P_element
PF13359   DDE_Tnp_4
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR000663   Natr_peptide       
IPR026960   RVT-Znf       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
459
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.56771
Exp number, first 60 AAs:
0.00021
Total prob of N-in:
0.00745
outside
1  -  459
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
130.658719
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号