SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08568
Annotation
PREDICTED:_uncharacterized_protein_LOC103311346_[Acyrthosiphon_pisum]
Location in the cell
Nuclear   Reliability : 1.495
 

Sequence

CDS
ATGGTCACAGTTGACGTACGCCCGGACGAGATCACACGTAATCCTACCTTCGAGTCTAGCACTGCAGCCTCCACTAATGCGTATGTGGGCTACAGTCGCTCGGTAGTTCTGTTGGGTACTTGTGTAGTTCGCGTTCGTCATCCTCGCAGTACTAATCAATCATTTCTTGTACGTGCGTTGATTGATAGTGGTGCTCAAGATTGTTTCATTACCAAGTCATGTTGTCAACGTTTGGGCTTACCATTACGTCGCTGTCCATTAGCCGTAGTTGGTCTAGGTCAAAATGCTGTACATCACGTGACTGGAGTTACTTCTTGCACTGTACTTTCTCGTACTTCAGAAAATCCTCATTTCAACATTAATCCTATCGTAGTAAATACTATAACGAGTAAAATGCCTGCTACAAACTTACCTACTAATCTTCGTGAATCTTTTAAACATCTGGTCCTCGCTGATGAGAATTTTGATAAACCATCAAATGTAGATTTACTACTCGGCGCAGAACTGTTCCATAGTATTTATGACGGTCAACGCGTTCAGCCCAGTCATGATCTACCGGTAGCTTTACACAGCGTATTTGGTTGGGTCATCACCGGCAAACTTGATACAAACCATTTACCTCCGCCAACAATATCTTCTCTCTTAGCATCCACACGTTCTCTAGACGAGGGACTCAAGCGATTCTGGGAGATCGAAGAACCTCCAAGTCAGGTTATCTTAAACCCTGAAGATATTAAATGTGAACAAATGTACTCAAATCTAACGTATCGTAATCCCGACGGCAGATATGTTGTACCTATGCTTCTCAAAGAACCTATCAGTCAACTAGGCGATTCTTTCAACCAATCTTTCTCTCGGCTCGTTAACCTAGAACGACGCCTTAATCGAAACTTAGAGTTGAAAAAAGAGTACACCGCCTTTATGCGCGAATACAAGCTGTTAGGGCATATGGAGCCTAGCGCTGACTCGAATAAAATCGGGCAGTATATAATTCCTCATCATTGTGTCATTCGCCCGGAAAGTACAACGACTAAACTTAGGGTTGTATTCGATGCTAGCGCCAAAACTACCAATGGCAAATCTCTTAACGATCTTGTATATACTGGTCCAAAACTTCAAAACGATATAGGAGATATACTTACAAAATTTCGGTTGCATGCTGTTGTTTTTACTGCCGACATCAGTAAGATGTATCGAAACATCGAACTTAGGCCAGAAGACCGAAAATGGCAGCATATACTTTGGCGCGATTCTCCTTCTGATCCTGTAACTGAGTATGAGCTGAAAACGGTAACCTACGGGGTTACGAGTTCCCCTTATCTGGCAATACGTACTCTGCATCAATTAGCCTCTGACTACGAAAAAGAGTGGCCCTTAGCAGCTGCTAGTCTTCGTCATGATACTTTCATGGATGACATCACTGTTGGTGCTACATCTATTGAAAGTGCACTGAAACATAAAGAAGAGTTAATACAAATGTTAGCGCGTGCTAAGTTCGAATTACGTAAATGGAGTAGCAACTCACCCGAATTCCTCACCCAGATACCAACGGAACATTGTCAAGTTCCAAAAACATTTTGTGATGAAAAACAAAAACAAAGTATCAAGATTCTTGGAGTCCAATGGGATCCAGCTGATGATAACTTCACTTATGCTTTATCAGAACTCGCTCCAGGGAATACAAAACGTGCTATTCTATCAAACGTCGCCAGAATTTATGATCCACTCGGATGGTTGGCCCCAATGGTTCTAATAGCTAAGCTTACCTTACAAGAACTATGGCGCCTTCAGCTTGACTGGGATGAAACTGTACCGTCAGAAATGTTGTCTCAGTGGCATCTATTTACATCCGAGTTTCACTACCTGAAGGATATTAAAATTCCTCGACTAATTGTACCTCTTCATTCAAAATCATACGAACTTGTAGGTTTTTGTGATGGATCTACCAAGGCTTATGGTTGTTCTGTGTACTTACGTATAACTACCGACAGTGAAATTACATCTCACTTGCTTATTGCAAAATCTAAAGTAGCTCCATTAAAAGTTCTTACTGTCAACCGATTGGAGCTATGTAGTGCTGTATTACTAGCAAAAATATTGAAGCATATTAGTAATTTACTAAATGAAACTCAAACCTCAAACATAACAATTTCAAAGATATGA
Protein
MVTVDVRPDEITRNPTFESSTAASTNAYVGYSRSVVLLGTCVVRVRHPRSTNQSFLVRALIDSGAQDCFITKSCCQRLGLPLRRCPLAVVGLGQNAVHHVTGVTSCTVLSRTSENPHFNINPIVVNTITSKMPATNLPTNLRESFKHLVLADENFDKPSNVDLLLGAELFHSIYDGQRVQPSHDLPVALHSVFGWVITGKLDTNHLPPPTISSLLASTRSLDEGLKRFWEIEEPPSQVILNPEDIKCEQMYSNLTYRNPDGRYVVPMLLKEPISQLGDSFNQSFSRLVNLERRLNRNLELKKEYTAFMREYKLLGHMEPSADSNKIGQYIIPHHCVIRPESTTTKLRVVFDASAKTTNGKSLNDLVYTGPKLQNDIGDILTKFRLHAVVFTADISKMYRNIELRPEDRKWQHILWRDSPSDPVTEYELKTVTYGVTSSPYLAIRTLHQLASDYEKEWPLAAASLRHDTFMDDITVGATSIESALKHKEELIQMLARAKFELRKWSSNSPEFLTQIPTEHCQVPKTFCDEKQKQSIKILGVQWDPADDNFTYALSELAPGNTKRAILSNVARIYDPLGWLAPMVLIAKLTLQELWRLQLDWDETVPSEMLSQWHLFTSEFHYLKDIKIPRLIVPLHSKSYELVGFCDGSTKAYGCSVYLRITTDSEITSHLLIAKSKVAPLKVLTVNRLELCSAVLLAKILKHISNLLNETQTSNITISKI

Summary

Similarity
Belongs to the synaptobrevin family.
EMBL
GALX01004947    JAB63519.1    GGMR01018294    MBY30913.1    ABLF02026240    ABLF02055027    + More
GBHO01006408    JAG37196.1    GBRD01007977    JAG57844.1    ABLF02025193    GBHO01038800    JAG04804.1    GFTR01008866    JAW07560.1    ABLF02041762    GGMS01014133    MBY83336.1    GBHO01039691    GBHO01039690    JAG03913.1    JAG03914.1    GECZ01008071    JAS61698.1    GGMR01017890    MBY30509.1    ABLF02012239    ABLF02012241    ABLF02017372    ABLF02042178    ABLF02066436    ABLF02015138    GGMR01006575    MBY19194.1    GBHO01044316    JAF99287.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    ABLF02066034    LBMM01012238    KMQ86334.1    GBHO01038805    GBHO01038804    GBHO01038801    JAG04799.1    JAG04800.1    JAG04803.1    ABLF02005684    ABLF02039606    ABLF02030854    ABLF02067347    GGMR01016460    MBY29079.1    ABLF02008594    ABLF02003339    ABLF02058001    ABLF02008635    ABLF02023121    ABLF02065930    ABLF02065931    GBHO01037783    JAG05821.1    GBHO01037781    JAG05823.1    GGMR01011131    MBY23750.1    GGMR01003897    MBY16516.1    GBHO01000059    JAG43545.1    GGMR01002024    MBY14643.1    GGMR01005823    MBY18442.1    GGMR01010723    MBY23342.1    RSAL01000392    RVE41994.1    GDHC01018192    JAQ00437.1    ABLF02008636    GGMR01014165    MBY26784.1    GBHO01000060    JAG43544.1    ABLF02041670    ABLF02054908    GDHC01016272    JAQ02357.1    GGMS01012504    MBY81707.1    GGMS01006636    MBY75839.1    GGMR01003717    MBY16336.1    ABLF02003736    ABLF02008292    ABLF02008294    ABLF02046909    ABLF02052378    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    GBHO01000061    JAG43543.1    GBHO01022454    JAG21150.1    GBHO01034062    JAG09542.1    GGMR01008932    GGMR01010920    MBY21551.1    MBY23539.1    GEBQ01015458    JAT24519.1    GEBQ01028569    JAT11408.1    ABLF02041650    GEBQ01000825    JAT39152.1    GGMS01014951    MBY84154.1    GEZM01054766    GEZM01054765    JAV73410.1    GBHO01007689    JAG35915.1    ABLF02041863    GEBQ01015737    JAT24240.1    GBHO01012499    GBHO01012498    GBHO01012497    GBHO01007479    GBHO01007451    GBHO01007450    JAG31105.1    JAG31106.1    JAG31107.1    JAG36125.1    JAG36153.1    JAG36154.1    ABLF02035780    ABLF02018732    ABLF02018737    GGMR01014351    MBY26970.1    GEZM01085145    GEZM01085143    JAV60187.1    GGMS01009443    MBY78646.1    ABLF02067195    GGMR01017784    MBY30403.1    GGMR01009860    MBY22479.1    ABLF02006784    JAV73413.1    GDHC01014268    JAQ04361.1    ABLF02036131    ABLF02041527    ABLF02064049    GAMC01006864    JAB99691.1    GGMR01013370    MBY25989.1    GGMR01002421    MBY15040.1    ABLF02005251    ABLF02055296    GBHO01034065    GBHO01034061    JAG09539.1    JAG09543.1    ABLF02021785    ABLF02028417    ABLF02042407    GGMR01002187    MBY14806.1    GBHO01030122    GBHO01030121    GBHO01030120    GBHO01030116    JAG13482.1    JAG13483.1    JAG13484.1    JAG13488.1    ABLF02030698    ABLF02030705    ABLF02030709    GGMS01012379    MBY81582.1    ABLF02002658    ABLF02034765    ABLF02042453    ABLF02034704    ABLF02034708    ABLF02034709    ABLF02044644    ABLF02055319    GGMR01019355    MBY31974.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GAMC01020552    JAB86003.1    ABLF02028666    ABLF02066713    GGMR01010198    MBY22817.1    ABLF02009779    ABLF02067216   
Pfam
PF18701   DUF5641        + More
PF05380   Peptidase_A17
PF03564   DUF1759
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00665   rve
PF00078   RVT_1
PF13774   Longin
PF09337   zf-H2C2
Interpro
IPR001584   Integrase_cat-core        + More
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR008737   Peptidase_asp_put       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR017907   Znf_RING_CS       
IPR011012   Longin-like_dom_sf       
IPR010908   Longin_dom       
IPR001995   Peptidase_A2_cat       
IPR015416   Znf_H2C2_histone_UAS-bd       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       
SSF64356   SSF64356       
Gene 3D
PDB
4OL8     E-value=0.0267752,     Score=90

Ontologies

Topology

Length:
720
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0442800000000001
Exp number, first 60 AAs:
0.03275
Total prob of N-in:
0.00194
outside
1  -  720
 
 

Population Genetic Test Statistics

Pi
269.438838
Theta
179.14795
Tajima's D
1.605532
CLR
279.23354
CSRT
0.810059497025149
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号