SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08556
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Mitochondrial   Reliability : 2.632
 

Sequence

CDS
ATGGCGACGTCCGATAGCCAACATGTACCTGGTCGCCTATTTGTTTCTGATCGGAAAACGAAGATGCAGTTTTTAGTTGATACTGGCAGCGATCTCTGCGTCTTCCCCCGCACCGCTCTACGCGAATGGCGATCACCCACCAGCTACAAACTCTACGCAGCAAACGGAACTGCCATAGCCACCTACGGTTTCGCTCATCTAGAGTTGAACTTGGGCCTCCGTCGTGCCTACCAATGGCGTTTCATCGTGGCAGACGTCACAAAAGCCATCATTGGAGTCGACTTTCTATCATTCTACGGCCTCATCGTCGATTGCCGTAATCATCGCCTAATCGACAGCACTACGACATTGACGACACCAGCAGCTGCAGTTTTATCGTCGAACACTATTTCTTCTGTGAAGACATTGATCGGCGAAACAGCTTACCATCAATTACTGCGTCAATTTCCTGAGATAACGCGCCCTGCTGGGACCGACCGTGTCATCCATCACGGCACAGTCCACCATATACGGACTACGCCGGGACCTCCAATTTCATGTGCTCCACGCCGCTTAGCTCCGGATAAACTGCTTATCGCCAAAGAACAATTCGCAGCTATGCTGAAAAATGGAACTGCTAGACCATCAGAGAGTCTATGGTCATCACCTCTCCACTTAGCACCGAAGAAAAGCAGCGGATGGCGTCCATGCGGTGATTACAGGATGTTGAATGCGAGAACGATTCCTGATCGCTACCCCATACGCAACATTCACGATTTCACCCACAATATTTCTGGATGCCAGGTATTCTCTACCATAGACCTGGTAAAAGCTTACAATCAGATTCCAGTAAACAGCGAGGATATAGCAAAAACCGCAATAACAACCCCGTTTGGTCTATACGAGTTTCCGTATATGACTTTCGGACTCAGAAACGCAGGCCAAACGTTCCAACGCTTTGTGGACGAGATGACAAGAGGTTTGGACTTCACTTACGCTTTCTTGGACGATTTTTTGATATTTTCCCGGGATGAATCTTCCCACAGGAATCACCTACGCCAAATATTTGAAAGGCTCAAACAATATGGCATGGTAATAAATACATCGAAATGCGTATTTGGAGCGTCAGAAGTTACTTTCCTAGGCTACAAGGTTTCATCTGCCGGAATCAAGCCCTTGGAAACAAAAGTAGATGCAATCAGAGCATTCCCAGTACCAAAAACTGCTAAAGAACTACGCCGCTTTCTGGGAATGCTAAATTTCTACCGGAAGTTCATACCTGACGCAGCTAAAATTCAAGCGCCACTTCACATGTTACTAACCGACAAAATAAAAGGTTCTCACCCTGTAAACATCGCTGGTGACGCATTATACGCATTTGAAGAATGTAAAAACAGCCTATGCCGTGCTACATTGCTGGCACACCCTGACGCAGATGCGAAAATGGCAATCGTCACAGATGCTTCAGATACCGCAATTGGTGCTGCTCTTCAGCAATGTAAGAATAATACTTGGGAACCTCTAGCGTTTTTTTCACGGAAACTCAGTCCATCACAAGTAAAATACTCTCCTTACGACAGGGAGCTACTTGCGATCTATGAGGGAATCCAACATTTCAGACACATGCTAGAAGCTCGACATTTTACCGTATACACGGATCACAAGCCCATATGCTACGCATTCGCTACCAGGAAAGATAAGTGCTCACCTCGACAGTTCCGCCACCTCGACTATATTTCGCAGTTTACGACAGATATACGTCACATATCTGGGAAAGAAAATGTCGTGGCAGATACTTTATCGAGAATTGAAGAAGTAGCACAACCCATCGACCTGATACAGTTAGCGAAATCACAAGATAGCGATCCAGAGCTAAAACGTTTACTAAAAGAGGAATCAACGTCACTGACCTTTCGTAAGCTAACTATACCTGGAACAAAAACACAGCTGGTTTGCGATGACAGCCAACAACTTCCACGGCCATTCGTCACAGCACCGTTTCGACGTCAAGTATTCAATAACTTGCATTCACTGAGCCACCCTGGCGCTGCAGCAACTGCAAAGTTAGTAGCCCAGCGCTACGTATGGCCCAGTATGAGAAAAGATTGCCGTGAATGGACGAGGTCATGTCATTCCTGTCAACATTCCAAGATTACCCGACATGTAACCGTAACTCCTGGAACATTTCAATTACCACGGGCCAGATTTACCACTATACATATAGACCTAATAGGTCCAATGCCAATATCGAACGGCTATAAGTATTGCCTAACCATCGTTGATCGATTTACAAGATGGCCAGAAGCCATACCGATCATGGACATAACGGCCGAAACCGTAGCTAAAGCCCTGATATCTGAATGGATAGCACGCTTTGGTTGCCCTACCGCCGTTATCACTGACAGAGGACGGCAATTCGAATCGGTCCTATTTAACAATTTGGCTGAAATGGTCGGGTTCGAGCACAAACGAACGACGGCTTATCATCCTGCATGCAACGGCATGGTTGAAAGATTTCACAGGCAGTTGAAGGCTGCTATAGTATGTCACTCAACATTAAATTGGACAGAATCACTACCACTTGTCTTACTCGGAATCCGAAACACCTTTAAAGAAGACATTCAAGCGTGTCCGGCTGAGTTAGTATACGGAGAAACGCTTCGATTACCAGGGGAATTGTTTCATTCATCCAAAAACAAAACAGATGATCTTACCGATTTTATGACTAGACTCCGATCGATAGTGAAGGATATACAACCGCAACCCGCATCTAGGCACTGCAAGAAAACAACATTGTTTTTAAGGATCTCGCTACAACAACCCATGTTTATCTAA
Protein
MATSDSQHVPGRLFVSDRKTKMQFLVDTGSDLCVFPRTALREWRSPTSYKLYAANGTAIATYGFAHLELNLGLRRAYQWRFIVADVTKAIIGVDFLSFYGLIVDCRNHRLIDSTTTLTTPAAAVLSSNTISSVKTLIGETAYHQLLRQFPEITRPAGTDRVIHHGTVHHIRTTPGPPISCAPRRLAPDKLLIAKEQFAAMLKNGTARPSESLWSSPLHLAPKKSSGWRPCGDYRMLNARTIPDRYPIRNIHDFTHNISGCQVFSTIDLVKAYNQIPVNSEDIAKTAITTPFGLYEFPYMTFGLRNAGQTFQRFVDEMTRGLDFTYAFLDDFLIFSRDESSHRNHLRQIFERLKQYGMVINTSKCVFGASEVTFLGYKVSSAGIKPLETKVDAIRAFPVPKTAKELRRFLGMLNFYRKFIPDAAKIQAPLHMLLTDKIKGSHPVNIAGDALYAFEECKNSLCRATLLAHPDADAKMAIVTDASDTAIGAALQQCKNNTWEPLAFFSRKLSPSQVKYSPYDRELLAIYEGIQHFRHMLEARHFTVYTDHKPICYAFATRKDKCSPRQFRHLDYISQFTTDIRHISGKENVVADTLSRIEEVAQPIDLIQLAKSQDSDPELKRLLKEESTSLTFRKLTIPGTKTQLVCDDSQQLPRPFVTAPFRRQVFNNLHSLSHPGAAATAKLVAQRYVWPSMRKDCREWTRSCHSCQHSKITRHVTVTPGTFQLPRARFTTIHIDLIGPMPISNGYKYCLTIVDRFTRWPEAIPIMDITAETVAKALISEWIARFGCPTAVITDRGRQFESVLFNNLAEMVGFEHKRTTAYHPACNGMVERFHRQLKAAIVCHSTLNWTESLPLVLLGIRNTFKEDIQACPAELVYGETLRLPGELFHSSKNKTDDLTDFMTRLRSIVKDIQPQPASRHCKKTTLFLRISLQQPMFI

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01009142    KMQ88359.1    LBMM01013040    KMQ85849.1    LBMM01013103    KMQ85815.1    + More
LBMM01012479    KMQ86204.1    GBXI01015889    JAC98402.1    GBXI01017046    JAC97245.1    GFXV01006394    MBW18199.1    GBXI01003773    JAD10519.1    LBMM01012134    KMQ86388.1    EF426679    ABP48077.1    KQ971355    EFA07205.2    GEGO01003687    JAR91717.1    KL363241    KFD51254.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    LBMM01001181    KMQ96765.1    GFDL01003994    JAV31051.1    LBMM01012160    KMQ86374.1    AAGJ04001742    GGLE01003443    MBY07569.1    KQ973093    EFA13472.2    GEGO01004475    JAR90929.1    AAGJ04130731    LN877232    CTR11708.1    GEGO01001281    JAR94123.1    GEDV01001796    JAP86761.1    DF142933    GAA49140.1    GGFK01003401    MBW36722.1    BN000802    CAJ00250.1    GGFK01003442    MBW36763.1    QMKO01001896    RTG85859.1    QMKO01001891    RTG85893.1    LBMM01008151    KMQ89105.1    GEGO01004686    JAR90718.1    GEGO01000286    JAR95118.1    GGLE01001814    MBY05940.1    GEZM01017686    JAV90495.1    GFPF01012375    MAA23521.1    AY013569    AAK07487.1    BK004070    DAA04500.1    AY013565    AAK07486.1    GEGO01004484    JAR90920.1    LBMM01012030    KMQ86466.1    AY013563    AAK07485.1    GACK01008900    JAA56134.1    LBMM01012567    KMQ86146.1    BK004066    DAA04495.1    KL367655    KFD60653.1    CABG01000050    CAZ37786.2    GEGO01004649    JAR90755.1    GDKW01003376    JAI53219.1    AAGJ04172791    AAGJ04112098    GEGO01003506    JAR91898.1    ABLF02030693    ABLF02030697    LBMM01012633    KMQ86092.1    MRZV01001828    PIK35719.1    FN356213    CAX83702.1    KL367543    KFD65158.1    KL367544    KFD65142.1    KL367778    KFD59660.1    GDHF01001116    JAI51198.1    GDHF01021808    JAI30506.1    GDHF01014424    JAI37890.1    KL367555    KFD64489.1    LBMM01012451    KMQ86215.1    KL367492    KFD69854.1    KL367664    KFD60497.1    JYDV01000002    KRZ45603.1    ABLF02005645    ABLF02042063    JYDT01000067    KRY86703.1    AAZX01013940    JYDR01000002    KRY79251.1    AAZX01023279    ABLF02057446    ABLF02059301    FN356212    CAX83701.1    AAGJ04000250    GBYB01009311    JAG79078.1    AAZX01006801    AAZX01023483    AAZX01009606    NIVC01003188    PAA52757.1    GGMR01003899    MBY16518.1    ABLF02040931    ABLF02040938    JYDO01000387    KRZ65366.1    KL367479    KFD72009.1    LBMM01006500    KMQ90563.1    AY662653    AAT98609.1    AAZX01004786    ABLF02007585    KL367552    KFD64647.1    ABLF02058233    GGMR01014794    GGMR01019265    MBY27413.1    MBY31884.1    JWZT01004124    KII64665.1    KL367564    KFD63933.1    KL363373    KFD46409.1    JYDR01000355    KRY64563.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF01087   GalP_UDP_transf
PF17917   RT_RNaseH
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
Interpro
IPR036397   RNaseH_sf        + More
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR013032   EGF-like_CS       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR041373   RT_RNaseH       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
PDB
4OL8     E-value=3.2708e-78,     Score=746

Ontologies

Topology

Length:
937
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.94455999999995
Exp number, first 60 AAs:
1.69902
Total prob of N-in:
0.16407
outside
1  -  937
 
 

Population Genetic Test Statistics

Pi
0.071213
Theta
0.322841
Tajima's D
0
CLR
0
CSRT
0.530373481325934
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号