SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08548
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS       + More
Probable RNA-directed DNA polymerase from transposon X-element      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 1.838
 

Sequence

CDS
ATGGTCAGGAACGACAGGCTCTCTGCCCGTGGTGGTGGTACCGTCATTTACTATAGAAGAGCCCTGCATTGCGTCCCGCTCGATCCTCCCGCGCTCGCTAATATCGAAGCATCAGTGTGCCGAATCTCACTGACGGGACACGCGCCGATCGTTATCGCGTCCGTTTATCTTCCACCGGATAAGATCGTTCTAAGCAGTGATATCGAGGCGCTGCTTGGTATGGGGAGCTCTGTCATTCTGGCGGGCGACCTAAATTGTAAACACATCAGGTGGAACTCACACACCACAACCCCGAATGGCAGGCGGCTTGACGCGTTAGTCGATGATCTCGCCTTCGATATCGTCGCTCCGCTAACCCCGACTCACTATCCGCTAAATATCGCGCATCGCCCGGATATACTCGACATAGCGTTATTAAAAAACGTAACTCTGCGCTTACACTCGATCGAAGTAGTTTCAGAGTTAGATTCAGACCACCGTCCCGTCGTTATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCCGTCACGAGGACTGTGGTGGATTGGCACACGCTGGGCATCAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAACCCGGACTCTATCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACCTCGACATTAGATAGGTCATCGAAACAAGTTGTAGCGGAGGACTTCCTTCACCGCTTCAAATTGTCCGACGATATTAGGGAACTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCCTACAACGCGACGTAAAGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTATTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTAGACAGTGAGGTAGAACGCAGAGCCTCCTTGCCACCCTCTGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCGAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTTATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACAAAGTCTGGCACAATGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGACCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCCCTCCTATTTAGCTTATTCGTCAACGATATTCCCCGGTCGCCGCCGACCCATTTAG
Protein
MVRNDRLSARGGGTVIYYRRALHCVPLDPPALANIEASVCRISLTGHAPIVIASVYLPPDKIVLSSDIEALLGMGSSVILAGDLNCKHIRWNSHTTTPNGRRLDALVDDLAFDIVAPLTPTHYPLNIAHRPDILDIALLKNVTLRLHSIEVVSELDSDHRPVVMKLGRAPDSVPVTRTVVDWHTLGISLAESDPPSLPFNPDSIPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLHRFKLSDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVKSRIAEVRDARWSDFLEGLAPSQRSYYRLARILKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVDSEVERRASLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDKVWHNVSCSSYGTSCRTALFDIESREPAPPHDLSQLESRKALSSHPSYLAYSSTIFPGRRRPI

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
At least 30 copies of X-element are present in the genome and some elements are polymorphic between different strains.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB055391    BAB21761.1    AB018558    BAA76304.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    GBBI01004395    JAC14317.1    GGMS01006359    MBY75562.1    ABLF02042385    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMR01015412    MBY28031.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GGMR01018716    MBY31335.1    GALX01005359    JAB63107.1    GGMR01016297    MBY28916.1    ABLF02008153    ABLF02008462    ABLF02008464    ABLF02042518    ABLF02057746    GGMR01004661    MBY17280.1    GFTR01008262    JAW08164.1    GEBQ01004157    JAT35820.1    KK115285    KFM64681.1    GFTR01008279    JAW08147.1    GGMR01000226    MBY12845.1    GEDC01029594    JAS07704.1    KK119261    KFM75202.1    ABLF02005245    ABLF02013477    ABLF02047385    ABLF02066435    ABLF02024246    GFTR01008261    JAW08165.1    GFTR01008271    JAW08155.1    ABLF02040174    ABLF02040183    ABLF02055266    KK118005    KFM71947.1    NEVH01006736    PNF36716.1    ABLF02034467    ABLF02007779    ABLF02007782    ABLF02050375    GGMR01002322    MBY14941.1    GGMR01012443    MBY25062.1    KK113281    KFM59799.1    GGMR01016905    MBY29524.1    GGMR01006581    MBY19200.1    GFTR01008038    JAW08388.1    GFTR01008256    JAW08170.1    GFTR01008251    JAW08175.1    GGMR01013409    MBY26028.1    GEZM01084970    JAV60359.1    GGMR01003864    MBY16483.1    GGMS01002786    MBY71989.1    GGMS01002992    MBY72195.1    ABLF02041767    GEZM01053022    JAV74219.1    GGMS01006655    MBY75858.1    AY060438    AAL25477.1    GEZM01084969    JAV60363.1    GFTR01008260    JAW08166.1    GFTR01007929    JAW08497.1    GFTR01008257    JAW08169.1    GFXV01000908    MBW12713.1    ABLF02028535    ABLF02028545    ABLF02023911    NEVH01023280    PNF18085.1    LBMM01014024    KMQ85369.1    GGFL01005012    MBW69190.1    GFXV01002840    MBW14645.1    GGMR01012676    MBY25295.1    KF280391    AIE77315.1    GGFL01004957    MBW69135.1    GGMR01000676    MBY13295.1    ABLF02041861    ABLF02022418    GBBI01004571    JAC14141.1    NEVH01009134    PNF33528.1    NEVH01011985    PNF31054.1    NEVH01027074    PNF13841.1    ABLF02013806    ABLF02016612    ABLF02065839    ABLF02012739    ABLF02012741    NWSH01007753    PCG62823.1    NEVH01005277    PNF39135.1    GFTR01008246    JAW08180.1    NEVH01021205    PNF19912.1    GGMR01006408    MBY19027.1    GEZM01021881    JAV88842.1    NNAY01003095    OXU19992.1    GGMR01011511    MBY24130.1    ABLF02034460    AF237761    AAF81411.1    GGMS01017365    MBY86568.1    RSAL01000708    RVE41206.1    GFTR01008151    JAW08275.1    GECL01003538    JAP02586.1    NEVH01016302    PNF25823.1    NEVH01019963    PNF22185.1    KU543673    AMS38352.1    GGMR01012305    MBY24924.1    ABLF02014118    ABLF02014121    ABLF02054790   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
PF04937   DUF659
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
604
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
5.29205999999999
Exp number, first 60 AAs:
0.05473
Total prob of N-in:
0.03066
outside
1  -  604
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
83.240917
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号