SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08527
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.289
 

Sequence

CDS
ATGAGTGACGCCAATGGCGCGCTCTTTTTGAAGTTCGTCCGTGATTTTTGTCCGGACATCATCACGAGATTTGAAGCCTACAAGGCCGGCCTTGACGCGTCGGCTCTCCGCGACTCCCCGTTGTCGCCCCCCGCGCCGGTACCTCGCGACTCGCCGATGTCGCCCCCCACCCCCGCGCCCGCGTCGATCGCGTCCTCCGTAGCGGTAAGCTCCGGCTCCGACTCCGAGTCGGAAATGGAGTACGAGTCCGCCGCTAGTCCCCAACCGGGAACCTCGGAAGGGTTCACCACCGTCGCGCGCGGGAAAAAACGCGCCCGCGCCGTGGAACCGACCGCAGCGCCGAAACAGCCCAAGGCCGCGAACGCGTCGCGTCCTAAAGTCGTGGTCACACCCGACTCCCCTCGCCGCGCAACTCCGTCGCCGCGCCCCGGGCCCGCGCCCGTCCGAAAAGTTCCCGCGCCGCCGCCGGTCATCCTGCGGGAAAAATCTTCTTGGGATCGCGTGTCCCTGGCCCTTAAGGCCCAAAAGATCAATGTCGTCCATGCGAGGAATATCCCGCATGGAATTCAGATCAAGGTTGAGACATCCGACGACCATAGGTCGTTGACCGCGTACCTCCGCAAGGAACGCATAGGGTATCATACCTATGCGCTCCAGGAGGAGCGTGAACTCCGCGTCGTAATACGCGGAGTCCCCAAAGAGCTCGACGTCGAGCAAATCAAGAATGACCTGGTAGGTCAGTCCTACCCCGTCATAAGTGTGCACCGGATGCACAGCGGGCGCGACAAATTCGCGTACGATATGGTGCTCGTAGCACTAGAAGCCACACCGGAGGGCAAAAAAATTGCCTCATGTCTCCGCACCGTGTGCGGCCTATCGGGGGTCACCGTAGAGGCCCCCTACAAACGCGGCACTCCCGGGCAGTGCCACCGTTGCCAGCTATATGGCCACTCCGCGCGTAACTGCAACGCGCGACCGCGTTGCGTGAAATGTTTAGACGATCACGCGACCACCGATTGCTCGCGCATGAAGGAGACAGCGACGGAGCCGCCGAGCTGTGTACTCTGCCGCAAGCAGGGACACACGGCCAACTACCGTGGATGCCCCAAGGCTCCACGGAAGCGCCCGGCAAACGCGCCCCCTAAAACCGCTGGCCCAAAGACTTCGGCGCCCCGCGCGCCGAAACCGGCTTTCGTACCGGCTCCGGTGCCCACCGTCTCCGCGTGGGCGAAACCGTTGCCGTTCACGAAGGCAGGAACGACACCGGCACCCCAACCGCGGTACGCGCCGCAACCTCTACTCGCGCCGCGCCCCGCCCCCGCGCCCGCGCCCGGTCCCGCGCCTCGCCCCGGCCCCGCGCACTCAAACGATTTTACAATTATTCGCGACTACATCGCCGCGATAAACATCGACCGCATGCGTGCGTTCGCCGACGCCATGCGCAGAGCGGTCACGGCCGAAGACCGCCTAAACGCGACGTTCGAGTACATCGACGTCATCGAGTCCGTCCAGCGCACGCTGCGCGACCAGGTTTATGAGTTTCTACGTGACAATCTCATCGACATCCTTCTGGTGCAGGAGACCTTCCTAAAGCCCTCGCGTCGCGACCCCAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCTCCACCCGCAAGGGCGGTACTGTCATTTACTATAGGAGGGCCCTGCACTGCGTCCCTCTCGATACTCCCTCGCTCTTACATATCGAGGCGTCAGTGTGCCGCATCGCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTATATCTCCCTCCTGACAAACCCCTCCTGAGCAGTGACCTCGAGACACTGCTCGGTATGGGGGACGCGGTCATTCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAGATATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTGCGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGACACCGTCGAATCCATAAATATCTTCACTGATCACGTCTCGACGGCGATCACAAGATCTTCAAAGCAAGTTGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTGAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAAAAGAACTCGCGCCCACTCACCAAGCATACTGGCGACTAGCTAGGACCCTCAAGTCCGAAACTATCGTCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTGCAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTAATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAACAAAATTCTGATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCAATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAGTGCCAGACAGGCTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATCGAGTTGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCCCTCTCCCCGTTACTATTCAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCAGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTAGGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGAGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCATTCCAAGTCATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCACCAGTAAGTATATGCAGTCGGCGTCTACGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCAAAACACGTCATCTCGGATCCTCCCGATCCACTAACGGTGCTTCTAGGTACTTCAAGCACCGGTCACCGTTCTCGTCGAACCCGTCGCTTGCGAAGAAGGGCTCGACGAGTAAATTAA
Protein
MSDANGALFLKFVRDFCPDIITRFEAYKAGLDASALRDSPLSPPAPVPRDSPMSPPTPAPASIASSVAVSSGSDSESEMEYESAASPQPGTSEGFTTVARGKKRARAVEPTAAPKQPKAANASRPKVVVTPDSPRRATPSPRPGPAPVRKVPAPPPVILREKSSWDRVSLALKAQKINVVHARNIPHGIQIKVETSDDHRSLTAYLRKERIGYHTYALQEERELRVVIRGVPKELDVEQIKNDLVGQSYPVISVHRMHSGRDKFAYDMVLVALEATPEGKKIASCLRTVCGLSGVTVEAPYKRGTPGQCHRCQLYGHSARNCNARPRCVKCLDDHATTDCSRMKETATEPPSCVLCRKQGHTANYRGCPKAPRKRPANAPPKTAGPKTSAPRAPKPAFVPAPVPTVSAWAKPLPFTKAGTTPAPQPRYAPQPLLAPRPAPAPAPGPAPRPGPAHSNDFTIIRDYIAAINIDRMRAFADAMRRAVTAEDRLNATFEYIDVIESVQRTLRDQVYEFLRDNLIDILLVQETFLKPSRRDPKVANYVMVRNDRLSTRKGGTVIYYRRALHCVPLDTPSLLHIEASVCRIALTGHQPIVIASVYLPPDKPLLSSDLETLLGMGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAITRSSKQVDVEDCFHRIRLSPDLRDLVRVRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLKELAPTHQAYWRLARTLKSETIVTMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFNIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTRRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQVIQSRFCRIAVGAPWFVRNVDLHDDLDLESTSKYMQSASTRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLGTSSTGHRSRRTRRLRRRARRVN

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00465721,     Score=100

Ontologies

GO

Topology

Length:
1444
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.538610000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00001
outside
1  -  1444
 
 

Population Genetic Test Statistics

Pi
139.35757
Theta
114.241008
Tajima's D
0.682432
CLR
0.041653
CSRT
0.568971551422429
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号