SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08520
Pre Gene Modal
BGIBMGA000917
Annotation
Uncharacterized_protein_OBRU01_24833?_partial_[Operophtera_brumata]
Location in the cell
Nuclear   Reliability : 4.424
 

Sequence

CDS
ATGTTTACAAAAGCACGCAGCAACTCACTCGGTACTATACCGCAAGATATCAACGTCCCTGAAATAATATTTAGTACGAAAGATCAAATCAAGCACGACTGGCAGCAGGACAGAATTCCGCCAGCCAAAAGAAAGAGAGTGGAAACCGACTCCCCACAGACTGAAAAGGTAAAGAAAAAGCCTAACACAACTACTTATGCTATTACTACAAAGAATCAATTCGATATTTTAGACAGTGAGGAATCTACAACAGACAATATAGAAATAGATAAACCACCAAAACCAGAACCAATATTTGTTACTGGTGTCCTGGATATCAGCGCCCTCCGAAATAAATTGAAAGAAATTGCATCAGCAGACGACTACACTATGACAACACTCAAGTCAGGACACATTGTGAAAATAATGCCAGCAAGTATAGAAATATATAAATCAATACGAGAAAATTTTATCTCAGACAATATTAGCCATTACACATACATGTTAAAGAGCGAAAGACCATACAGAGTTGTACTGAGAGGCCTCCACAGCTCAGAGGATACTACTGAAATAAAGGAAAAACTCAAAGAACACGGGCACGAAGTAAGGCAAATTGTAAATGTACGCCACCGAACCTCAAAAGAACCTCTACCTTTGTTCTATGTAGACCTGGAACCCAAGCCAAGCAATAAAGATATATTTAATTTAAAATTCCTAAATCACATGAAGGTATCGTTCGAACCGCCCTACAAGAAAAAAGAAATTATCCAGTGTAAGAGGTGTCAAAGATTTGGTCACTCTAAAAATCAGTGCTACCGACCTTTCAGATGCGTCAAGTGCGGAGAAGACCACCCCACCAGCACCTGTAAAAAAACTAAAGACACAGAAGCTACATGTGCGAACTGTCAACAAAAGCACCCTGCTAGTTATAGAGGATGTGTTAAATATAAACAATACAAGGAGCATATACTGAAAATACAACCGAAAAACACGCACACAAATATAATAAACAGACAAACCAGACTCCCAGATGTAGATATTCCACAACCTAAGAAATTTAGTACCAGTAATAAAAATAGACTAACTTATGCTGAAGCAATAAAATCTAAAACAGACAACATAATTAACTCAAACGAACCGCTTCAAGTGCAACAACTGGGTGACATCCTGGATAAGATGTTCAACAGAATTCAAACCATGATGATCAACATGGTAGACAACATGATGGACAGTGTGGAATCTGACTTAGATCTCACATCAGACCATTCTGCAGTTATTCTAAACCTGAATAATAAGATAATATTAAATGATGCACCACCCAGAATCTACAATAAAAAAACAAACTGGGAAGAATACAAAAATATTATCACAGCAGAAGCACAGCTCATGGTGCCACTGAAAACAGTAGAAGAAGTTGAACAAGCCATTGAAAACCTAAATGGATTGATCCATAGCGCAGCTAATAGGTCCACACCCCAAGGTAAAGCTAGTAGTGCTAAAGAGCATGTATACCCTGCGTTCATTAGGGACAGAGTAACTGAAAGACGTCGACTCCGCAGAGAATGGCAAAACAACCACTATAAAAGAGACAAAACTGCTTTTAATAAAGCATCGCAGCAACTAAAGGCGCTAACGAAACAATGGGCAAATGAGAACTTACAAAGTTACCTCACAAAGCTGACACCTACTAGTGACACAAATTACTCTCTGTACAAAGCTACAAAAAACATGAAGCGTCCAAAACAACAGGCTACACCTATAAAAACACAACTAGGGACCTGGGCCCGCTCCGACGGTGAGAAAGCTACTACATTTGCAGAGCATTTACAAAAAGTATTTGAGCCACCTCCCAGCAACGACCAAAGCCTAGACAATGAAATAGACGAATACTTAAGTTCTCCAAATCAGATGTGCCTACCGTTGAAACATGTCACGCTTAATGAACTAAGACGGGACATCCGAAAACTTAAACAAGGTATGCACCTCGACCGACGGCTCACGTGGTGCAAACATATATGGACAAAAAGGAAACAGCTGGACTGCAGACTCAGAGGCATGTACTGGCTTATTGGACGCAAGTCGCAGCTTTCAGACGCCAGTAAAATGACAATTTACAAAACAATACTGAAGCCTGTATGGACATATGGCATACAAGTATGGGGCACTGCCAGTCACAGTAATATAGAAATATTAGAGCGTTTTCAGAGCAAAACAATGAGAACCATGTTCAACATTCCACCATACATAAGCAACAAATATGTAAATCTTGATTTGAATCTGAGAACAGTGAAGGAAGAAATCGAAACATACAGCAAGAATTACCAAACACGACTTGACCAACACATTAATCAGCTAGCTGCAGAGCTGCAGGGGGAGGGCAGCCTAAGATACTCTCGCCTGAAAAGGAGTAGTATACCAGACCTAGCAAAAAGATTTGCAGATATAAGATGA
Protein
MFTKARSNSLGTIPQDINVPEIIFSTKDQIKHDWQQDRIPPAKRKRVETDSPQTEKVKKKPNTTTYAITTKNQFDILDSEESTTDNIEIDKPPKPEPIFVTGVLDISALRNKLKEIASADDYTMTTLKSGHIVKIMPASIEIYKSIRENFISDNISHYTYMLKSERPYRVVLRGLHSSEDTTEIKEKLKEHGHEVRQIVNVRHRTSKEPLPLFYVDLEPKPSNKDIFNLKFLNHMKVSFEPPYKKKEIIQCKRCQRFGHSKNQCYRPFRCVKCGEDHPTSTCKKTKDTEATCANCQQKHPASYRGCVKYKQYKEHILKIQPKNTHTNIINRQTRLPDVDIPQPKKFSTSNKNRLTYAEAIKSKTDNIINSNEPLQVQQLGDILDKMFNRIQTMMINMVDNMMDSVESDLDLTSDHSAVILNLNNKIILNDAPPRIYNKKTNWEEYKNIITAEAQLMVPLKTVEEVEQAIENLNGLIHSAANRSTPQGKASSAKEHVYPAFIRDRVTERRRLRREWQNNHYKRDKTAFNKASQQLKALTKQWANENLQSYLTKLTPTSDTNYSLYKATKNMKRPKQQATPIKTQLGTWARSDGEKATTFAEHLQKVFEPPPSNDQSLDNEIDEYLSSPNQMCLPLKHVTLNELRRDIRKLKQGMHLDRRLTWCKHIWTKRKQLDCRLRGMYWLIGRKSQLSDASKMTIYKTILKPVWTYGIQVWGTASHSNIEILERFQSKTMRTMFNIPPYISNKYVNLDLNLRTVKEEIETYSKNYQTRLDQHINQLAAELQGEGSLRYSRLKRSSIPDLAKRFADIR

Summary

Uniprot
Pfam
PF14529   Exo_endo_phos_2        + More
PF07530   PRE_C2HC
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR006579   Pre_C2HC_dom       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

GO

Topology

Length:
809
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02348
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00011
outside
1  -  809
 
 

Population Genetic Test Statistics

Pi
36.753789
Theta
50.772672
Tajima's D
-0.4394
CLR
241.449991
CSRT
0.256137193140343
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号