Gene

KWMTBOMO08502

Pre Gene Modal

BGIBMGA009341

Annotation

PREDICTED:_peptidyl-prolyl_cis-trans_isomerase_D_isoform_X1_[Bombyx_mori]

Location

Bomo_Chr14(-):10972065-11015333      View in EpiBrowser

Full name

Peptidyl-prolyl cis-trans isomerase D      

Alternative Name

40 kDa peptidyl-prolyl cis-trans isomerase
Cyclophilin-40
Rotamase D
Cyclophilin-related protein
Estrogen receptor-binding cyclophilin

Location in the cell

Cytoplasmic   Reliability : 1.645 Nuclear   Reliability : 1.865

CDS

ATGAGTTCCGACAGGCGATCACAAACGAATCCTTTTGTTTATTTGGACATCTCTATTGATGGAGTATCAGCTGGACGAATCGTGATCGAACTGAGGAGTGACGTAGTCCCGAAAACCGCAGAGAACTTCCGGGCGCTTTGTACGGGCGAGAAGGGCATTGGAGTTTACGGGAAACCCTTACACTACAAAGGAGTCAGATTCCATAAAGCGGTTAATCAGTTCATGGTGCAGGGCGGAGACATAGTCAACGGCGACGGCAGCGGCGGCGAGAGCATATACGGCCCGAAATTCGAAGACGAGAATTTTACTCTTACGGCAAAGTCTGGGGTACTGGCGATGGCGAACGAAGGTCGACCGGACACAAACAGTTCGCAGTTCTGTATAACGACGATACCGTGCCCGCACATAAACGGCACTAATGTTATATTCGGGGAGGTGGTCGCCGGATTCGAACTGGTCGACGAGATGCAGAGATACGGCGAAGGGGACGACGGGAGGCCCGGGGCGGAATGCGTGATCGAAGACTGCGGCGAAATAACAGAGCAGAACTGGGACGTGTGCTGCAGGGATGGCACCTCCGACAAAATACCCGAATTCCCGACGGACTGGAGGAATATTGGAGCCGTTTCGTTAGACGATTTAATATCGTGCATAAGGGACGTCAAGGCAGCCGGCAATGGAATGTTCAGCGAGCGTCGGTACAAAGCCGCGATCAGAAAGTACCGCAAGTGCCTCAGATACGTCGACTACGCTTTGAGTATAGTACAAGGAATGCACGAGAAAGAGACAGAACATATAATAGATTTAACATCAACGTTTATACTGCAGTGTAATTTGAATCTGGCCGCGTGTTACTCGAGAACCGAAGACTACAGAGCGTGTATCGAGTGCTGTACGCAGGTGCTGGACAGAAGCCCTCGCAACGAGAAGGCCCTGTACCGGCGGGGCCAAGCGAACTTCGCCCTTAAGAACTACGAGGCCGCGCTGTCCGATCTGAGGCGGGCCGAGCGCGCGTCGCCGCACAATCGCGCCGTGCTCGCGCTGCTGGACGAGGTGCGCCGCTGCAGCCGCCGCTACAACGAGCTGCAGAAACAGAGGCTCTCAAAGTTTTTTCGTGAGCAAAAAGAGCGCGCCGCCGCCGCCAACAACTGA

Protein

MSSDRRSQTNPFVYLDISIDGVSAGRIVIELRSDVVPKTAENFRALCTGEKGIGVYGKPLHYKGVRFHKAVNQFMVQGGDIVNGDGSGGESIYGPKFEDENFTLTAKSGVLAMANEGRPDTNSSQFCITTIPCPHINGTNVIFGEVVAGFELVDEMQRYGEGDDGRPGAECVIEDCGEITEQNWDVCCRDGTSDKIPEFPTDWRNIGAVSLDDLISCIRDVKAAGNGMFSERRYKAAIRKYRKCLRYVDYALSIVQGMHEKETEHIIDLTSTFILQCNLNLAACYSRTEDYRACIECCTQVLDRSPRNEKALYRRGQANFALKNYEAALSDLRRAERASPHNRAVLALLDEVRRCSRRYNELQKQRLSKFFREQKERAAAANN

Description

PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity region. Involved in regulation of UV radiation-induced apoptosis.
PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding. Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity. Involved in regulation of UV radiation-induced apoptosis.
PPIase that catalyzes the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and may therefore assist protein folding (PubMed:11350175, PubMed:20676357). Proposed to act as a co-chaperone in HSP90 complexes such as in unligated steroid receptors heterocomplexes. Different co-chaperones seem to compete for association with HSP90 thus establishing distinct HSP90-co-chaperone-receptor complexes with the potential to exert tissue-specific receptor activity control. May have a preference for estrogen receptor complexes and is not found in glucocorticoid receptor complexes. May be involved in cytoplasmic dynein-dependent movement of the receptor from the cytoplasm to the nucleus. May regulate MYB by inhibiting its DNA-binding activity. Involved in regulation of AHR signaling by promoting the formation of the AHR:ARNT dimer; the function is independent of HSP90 but requires the chaperone activity. Involved in regulation of UV radiation-induced apoptosis. Promotes cell viability in anaplastic lymphoma kinase-positive anaplastic large-cell lymphoma (ALK+ ALCL) cell lines.
(Microbial infection) May be involved in hepatitis C virus (HCV) replication and release.

Catalytic Activity

[protein]-peptidylproline (omega=180) = [protein]-peptidylproline (omega=0)

Subunit

Identified in ESR1 or NR3C1/GCR steroid receptor-chaperone complexes. Found in HSP90 chaperone complexes with kinase clients LCK or EIF2AK1. Two monomers associate with one HSP90 homodimer. Interacts with HSP90AA1. Interacts with HSP90AB1; PPID and FKBP4 compete for binding to HSP90AB1 and the interaction is mutually exclusive with the PPID:HSPA8 interaction. Interacts with HSPA8; PPID and STIP1 but not FKBP4 compete for binding to HSPA8 and the interaction is mutually exclusive with the PPID:HSP90AB1 interaction. Interacts with S100A1 and S100A2; the interactions dissociate the PPID:HSP90AA1 interaction. Interacts with S100A6. Interacts with MYB, ILF2, XRCC6, RACK1 and RPS3. Interacts with cytoplasmic dynein 1 intermediate chain (DYNC1I1 or DYNC1I2).
Identified in ESR1 or NR3C1/GCR steroid receptor-chaperone complexes. Found in HSP90 chaperone complexes with kinase clients LCK or EIF2AK1. Two monomers associate with one HSP90 homodimer. Interacts with HSP90AA1. Interacts with HSP90AB1; PPID and FKBP4 compete for binding to HSP90AB1 and the interaction is mutually exclusive with the PPID:HSPA8 interaction. Interacts with HSPA8; PPID and STIP1 but not FKBP4 compete for binding to HSPA8 and the interaction is mutually exclusive with the PPID:HSP90AB1 interaction. Interacts with S100A1 and S100A2; the interactions dissociate the PPID:HSP90AA1 interaction. Interacts with S100A6. Interacts with MYB, ILF2, XRCC6, RACK1 and RPS3. Interacts with cytoplasmic dynein 1 intermediate chain (DYNC1I1 or DYNC1I2) (By similarity).

Similarity

Belongs to the cyclophilin-type PPIase family. PPIase D subfamily.

Keywords

Acetylation   Apoptosis   Chaperone   Complete proteome   Cytoplasm   Direct protein sequencing   Isomerase   Nucleus   Phosphoprotein   Protein transport   Reference proteome   Repeat   Rotamase   TPR repeat   Transport   3D-structure   Polymorphism  

Feature

chain  Peptidyl-prolyl cis-trans isomerase D
sequence variant  In dbSNP:rs2070631.

Uniprot

H9JIJ1   A0A2H1VXD7   A0A2A4JVR6   A0A2W1B6N7   A0A212EKZ2   A0A1I8N2U0   + More
A0A1A9WTN3   A0A1I8PTX9   B4QN98   B4HL81   K7J6J5   B3NCJ9   A0A084VCY4   Q9VT21   A0A067RL00   A0A0M3QW77   A0A1W4UMC2   A0A182RQ92   W8BMC2   D3TPY2   A0A0K8W0V4   A0A1A9UFZ0   A0A0L0C8M1   B4PEE8   A0A182Q0W1   Q641F7   A0A250XZF9   A0A034W0S0   D2A2T9   A0A182N574   H2PEM6   A0A088AV72   A0A2K6SY51   A0A0A9Z9H3   A0A2K6QXE7   A0A0K8T5L8   U5EYW6   A0A2Y9DVV3   A0A2K5CX43   A0A2K5SDA6   A0A2K5U0U8   A0A2K6A6Y4   A0A2K5MFH5   H9EVU2   A0A096N788   F7IL08   G1KSN5   A0A1S3GAL8   K7GBA2   G7NSZ6   A0A1U7QL23   G1R3M8   A0A2A3ETC7   Q3UB60   A0A3L7IHP4   G7P6H6   I7GL27   Q9CR16   A0A1U7SYN1   A0A2K5I5F7   A0A2K5UHD9   A0A182J317   A0A3Q2US37   A0A2K6KDJ4   I3IY94   A0A182MNW8   H0UVB7   G3TDA2   L5MLJ1   A0A1Z5L541   Q6P894   A0A1L8HUD3   A0A0M8ZTM2   A0A452J5W3   B4LHR5   Q6DGG0   A0A2J7PGH4   K9K4R4   S7MJ67   A0A2R9A916   H2QQC9   B4IY92   A0A2Y9F907   A0A2K6DSW2   A0A340WDL9   A0A1A7XW11   G3RAF0   A0A2Y9NSC0   A0A2K6QXE6   P26882   E5KN55   Q08752   A0A3P9NPY5   L8HPW4   F7DFM9   F1RTY6   A0A182HJD1   Q6FGM6   E5KN59   A0A341BJF3  

EC Number

5.2.1.8

Pubmed

19121390    28756777    22118469    25315136    17994087    22936249    + More
20075255    24438588    10731132    12537568    12537572    12537573    12537574    16110336    17569856    17569867    26109357    26109356    24845553    24495485    20353571    26108605    17550304    28087693    25348373    18362917    19820115    25401762    25362486    25319552    25243066    17381049    22002653    10349636    11042159    11076861    11217851    12466851    16141073    29704459    17194215    16141072    15489334    9195923    18771283    21183079    23806337    25186727    21993624    28528879    20431018    27762356    28562605    22722832    16136131    22398555    8514757    8509368    1544925    8621687    9915798    15497503    16650407    20188096    11377203    20843780    8812478    14702039    12665801    9659917    11525244    11350175    12145316    14580201    18708059    18669648    19690332    20676357    19932913    21146485    21269460    21711559    22681779    23220213    23186163    24275569    22751099    19892987   

EMBL

BABH01027085    BABH01027086    ODYU01004703    SOQ44864.1    NWSH01000476    PCG76137.1    + More
KZ150432    PZC70891.1    AGBW02014173    OWR42141.1    CM000363    CM002912    EDX09881.1    KMY98694.1    CH480815    EDW40900.1    AAZX01001318    CH954178    EDV51229.1    ATLV01011003    KE524632    KFB35828.1    AE014296    AY058303    AAF50235.1    AAL13532.1    KK852614    KDR20206.1    CP012525    ALC43663.1    GAMC01004310    JAC02246.1    EZ423484    ADD19760.1    GDHF01007546    JAI44768.1    JRES01000850    KNC27744.1    CM000159    EDW92986.1    AXCN02000166    BC082380    AAH82380.1    GFFV01003187    JAV36758.1    GAKP01011574    JAC47378.1    KQ971339    EFA01462.1    ABGA01009582    ABGA01009583    NDHI03003405    PNJ63182.1    GBHO01002540    JAG41064.1    GBRD01005003    JAG60818.1    GANO01001773    JAB58098.1    AQIA01056827    JU322744    JU322745    JU473029    JU473030    JU473031    JV045027    AFE66501.1    AFH29833.1    AFI35098.1    AHZZ02028075    GAMT01007734    GAMS01010887    GAMR01005540    GAMQ01001654    GAMQ01001653    JAB04127.1    JAB12249.1    JAB28392.1    JAB40197.1    AGCU01077551    AGCU01077552    AGCU01077553    AGCU01077554    AGCU01077555    AGCU01077556    CM001273    EHH30637.1    ADFV01178721    KZ288192    PBC34301.1    AK150520    AK151091    BAE30104.1    RAZU01000055    RLQ77121.1    CM001280    EHH54044.1    AB172112    BAE89174.1    AK003402    AK013919    AK051597    BC011499    BC019778    AQIA01084131    AERX01009909    AXCM01009363    AAKN02012071    KB098555    ELK38663.1    GFJQ02004839    JAW02131.1    AAMC01036942    BC061335    AAH61335.1    CM004466    OCT99660.1    KQ435850    KOX70900.1    CH940647    EDW69618.2    BC076386    NEVH01025635    PNF15420.1    JL616521    AEH58728.1    KE161484    EPQ04151.1    AJFE02078546    AACZ04005089    GABC01004090    GABD01006515    GABE01011524    GABE01011523    NBAG03000243    JAA07248.1    JAA26585.1    JAA33215.1    PNI63369.1    CH916366    EDV96542.1    HADW01020609    HADX01006315    SBP22009.1    CABD030034465    D14074    BC113318    L11668    HQ205146    HQ205147    HQ205148    HQ205149    HQ205151    HQ205152    HQ205153    HQ205154    HQ205155    HQ205156    HQ205157    HQ205158    HQ205159    HQ205160    HQ205161    HQ205162    HQ205163    HQ205165    HQ205166    HQ205168    HQ205169    HQ205170    HQ205171    HQ205172    HQ205173    HQ205174    HQ205175    HQ205176    HQ205177    HQ205178    HQ205179    HQ205180    HQ205181    HQ205182    HQ205183    HQ205184    HQ205185    HM005460    ADP90614.1    AEE61058.1    L11667    D63861    AY714221    AK313929    CH471056    BC030707    JH883514    ELR46335.1    AEMK02000065    APCN01002147    CR542081    CAG46878.1    HQ205150    HQ205164    HQ205167    ADP90618.1   

Proteomes

UP000005204    UP000218220    UP000007151    UP000095301    UP000091820    UP000095300    + More
UP000000304    UP000001292    UP000002358    UP000008711    UP000030765    UP000000803    UP000027135    UP000092553    UP000192221    UP000075900    UP000078200    UP000037069    UP000002282    UP000075886    UP000007266    UP000075884    UP000001595    UP000005203    UP000233220    UP000233200    UP000248480    UP000233020    UP000233040    UP000233100    UP000233140    UP000233060    UP000028761    UP000008225    UP000001646    UP000081671    UP000007267    UP000189706    UP000001073    UP000242457    UP000273346    UP000009130    UP000000589    UP000189704    UP000233080    UP000075880    UP000264840    UP000233180    UP000005207    UP000075883    UP000005447    UP000007646    UP000008143    UP000186698    UP000053105    UP000291020    UP000008792    UP000002494    UP000235965    UP000240080    UP000002277    UP000001070    UP000248484    UP000233120    UP000265300    UP000001519    UP000248483    UP000009136    UP000005640    UP000242638    UP000002281    UP000008227    UP000075840    UP000252040   

PRIDE

H9JIJ1    Q9VT21    Q3UB60    Q9CR16    Q6DGG0    P26882    + More
Q08752    F1RTY6    Q6FGM6    E5KN59   

Pfam

PF00160   Pro_isomerase        + More
PF13181   TPR_8
PF00515   TPR_1
PF07719   TPR_2
PF13176   TPR_7

Interpro

IPR029000   Cyclophilin-like_dom_sf        + More
IPR002130   Cyclophilin-type_PPIase_dom       
IPR013026   TPR-contain_dom       
IPR011990   TPR-like_helical_dom_sf       
IPR019734   TPR_repeat       
IPR001440   TPR_1       
IPR013105   TPR_2       
IPR020892   Cyclophilin-type_PPIase_CS       

SUPFAM

SSF48452   SSF48452        + More
SSF50891   SSF50891       

Gene 3D

1.25.40.10     2.40.100.10    

ProteinModelPortal

H9JIJ1   A0A2H1VXD7   A0A2A4JVR6   A0A2W1B6N7   A0A212EKZ2   A0A1I8N2U0   + More
A0A1A9WTN3   A0A1I8PTX9   B4QN98   B4HL81   K7J6J5   B3NCJ9   A0A084VCY4   Q9VT21   A0A067RL00   A0A0M3QW77   A0A1W4UMC2   A0A182RQ92   W8BMC2   D3TPY2   A0A0K8W0V4   A0A1A9UFZ0   A0A0L0C8M1   B4PEE8   A0A182Q0W1   Q641F7   A0A250XZF9   A0A034W0S0   D2A2T9   A0A182N574   H2PEM6   A0A088AV72   A0A2K6SY51   A0A0A9Z9H3   A0A2K6QXE7   A0A0K8T5L8   U5EYW6   A0A2Y9DVV3   A0A2K5CX43   A0A2K5SDA6   A0A2K5U0U8   A0A2K6A6Y4   A0A2K5MFH5   H9EVU2   A0A096N788   F7IL08   G1KSN5   A0A1S3GAL8   K7GBA2   G7NSZ6   A0A1U7QL23   G1R3M8   A0A2A3ETC7   Q3UB60   A0A3L7IHP4   G7P6H6   I7GL27   Q9CR16   A0A1U7SYN1   A0A2K5I5F7   A0A2K5UHD9   A0A182J317   A0A3Q2US37   A0A2K6KDJ4   I3IY94   A0A182MNW8   H0UVB7   G3TDA2   L5MLJ1   A0A1Z5L541   Q6P894   A0A1L8HUD3   A0A0M8ZTM2   A0A452J5W3   B4LHR5   Q6DGG0   A0A2J7PGH4   K9K4R4   S7MJ67   A0A2R9A916   H2QQC9   B4IY92   A0A2Y9F907   A0A2K6DSW2   A0A340WDL9   A0A1A7XW11   G3RAF0   A0A2Y9NSC0   A0A2K6QXE6   P26882   E5KN55   Q08752   A0A3P9NPY5   L8HPW4   F7DFM9   F1RTY6   A0A182HJD1   Q6FGM6   E5KN59   A0A341BJF3  

PDB

1IIP     E-value=3.88417e-70,     Score=673

KEGG

101741904    K05864 peptidyl-prolyl isomerase D [EC:5.2.1.8] | (RefSeq) peptidyl-prolyl cis-trans isomerase D

GO

GO:0003755   GO:0006457   GO:0051082   GO:0016018   GO:0042026   GO:0065003   GO:0043065   GO:0034389   GO:0045070   GO:0008134   GO:0000122   GO:0050714   GO:0051879   GO:0061077   GO:0005730   GO:0071492   GO:0005829   GO:0005528   GO:0005634   GO:0005654   GO:0005737   GO:0030544   GO:0005739   GO:0030331   GO:0031072   GO:0000413   GO:0015031   GO:0019899   GO:0006915   GO:0043066   GO:0006979   GO:0051881   GO:0019076   GO:0005515   GO:0019012   GO:0051603   GO:0030145   GO:0006412   GO:0016876   GO:0043039  

Subcellular location

Cytoplasm  
Nucleus  
Nucleolus  
Nucleoplasm  

Length:

383

Number of predicted TMHs:

0

Exp number of AAs in TMHs:

0.09648

Exp number, first 60 AAs:

0.0792999999999999

Total prob of N-in:

0.06601

outside

1  -  383

 

 

Pi

234.140133

Theta

176.753619

Tajima's D

1.272581

CLR

0.182658

CSRT

0.733363331833408

Interpretation

Uncertain