SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08486
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X4_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 1.576 PlasmaMembrane   Reliability : 1.06
 

Sequence

CDS
ATGGAAAGATTTAACCTTATTGCAATTGAGGATTTGCCCGCTGGGGAACCGATAGAGCAGGCATTGACGGAGCGAAGTACGTTGAATGTGGCGGCAGTGGTACGAGCACGCCATCTTCTAGATATAATATACAGATTTCTGTACATGGCAGCCGTAGTCCTTCGCCGTCACATAAACGTGTGCGTCGATCGCTTTGCCCAGACCAAGAACATGATACTACGAAGTGACGACGATGACAGCGATGATGAGAGCCAGAATGATAACGACGAAATCGTTCCCATGATTATCCCCCGGGCAGCTGGAATACTGATGGACACTCCGGACGACGAGGAGATTGAGATTGACACGGCGGCGGCAACTAAACCTCTTGTGACATCTTCCGCGCCTTCCATCATTTCAGCACCTACATCACCAGCGCGTGATACCGGTATGAAGCCTAGTCATTTTTTTGAATTTGACTGGGGAACTTTCCCTGACTCTCCTATACCGCCAACAGAAAGGCGTGAATCTTTTAAGGAACACTCTGGTCCCACTGTTGCTGTAAGTGACCCTTACGAGATTTTTAGACTTATTTGGGACCAGGAGTTCATGGAATTTATTGTGCAGGAAACAAATAGATATGCCCAACAATTAGCTGCTGAAATGTTGGACGGCGGGGAATTACAGGCCTCCAGTAGGATTACAGAATGGAAAGAAACCAATGTAGACGAGTTATTGGTGTTCTTCGGAATATTACTGGCGATGGGAATCGTCATAAAGAACCGGGTTGAAGAGTACTGGAATACGGAACAAAACATCTTCTCCACTCCAGGTTTCAAAGTATATATGTCGCTTAGGAGGTTCCAGTTACTCAGCAGGTGCTTACATTTTAATAATTCCGAGAACTTGAGAAACCTCAACCTGGATCCCTCACAGGCAAAGCTTTTTAAAGTGGAGCCTGTGATTAGCCATTTGAATTCCAAGTTCACGGAATTATATATAATGAAGCAGAACATTGCTTTAGATGAATCGCTGCTGCAGTGGAAAGGTTGGTTGAACATCAACCAATTTATTCCAAACAAAGCTGCAGCAGTGGGCATAAAAACTTACGAAATATGTGAGTCGCAGACGGGGTATTTATGGCGATTTAAAATCCATGCCCATAAGGCTTCGCCTACAGTCTCAGAGGCTGATCCATTCACAGCGAGTACACCGGCGTTGGTTCTTAACCTTATCAAAGGTTTAGAACACAAAGGATACACGTTGTGGATGGATAACTTCTACAATTCCCCAGCACTTGCCCGAAAACTCAAATCGATTGGGTTTGATTGTGTCGGTACGTTGCGGACAAACCGCAAGTATGTCCCGACGGAACTGACCAATCTGAAAAAATCTCAGATGAAGCCCGGGCAAGTAGTAGGCTATACCAGTGGAGATGTCGATTGCATAATATGGAGAGATCAGAACCGCGTAGCGACGATCTCAACGTACCATGGCAATGCCGTCTCCACTAAAAACGGAGTAACAAAACTTATTTTGATACGTGACTACAACATCTGCATGGGTGGCGTGGATAAAAAAGATCAGATGTTGGCTGCATTCCCAATTGAACGCAAGAGGACACAAATTTGGTACAAGAAATTGTTTAAAAGGAGAACACAAACTGGAAAATGCAGTGCAGGACGCCCTCGGGCCCGGTGGAGTGATGATCTGTGCAGGGTGGCTGGCAGGAACTGGATGAGTGAAACCGAGGATCGTGCTCAGTGGCGAACAATTGGAGAGGCTCATGTCCAGCAGTGGACTGCTATAGACTGA
Protein
MERFNLIAIEDLPAGEPIEQALTERSTLNVAAVVRARHLLDIIYRFLYMAAVVLRRHINVCVDRFAQTKNMILRSDDDDSDDESQNDNDEIVPMIIPRAAGILMDTPDDEEIEIDTAAATKPLVTSSAPSIISAPTSPARDTGMKPSHFFEFDWGTFPDSPIPPTERRESFKEHSGPTVAVSDPYEIFRLIWDQEFMEFIVQETNRYAQQLAAEMLDGGELQASSRITEWKETNVDELLVFFGILLAMGIVIKNRVEEYWNTEQNIFSTPGFKVYMSLRRFQLLSRCLHFNNSENLRNLNLDPSQAKLFKVEPVISHLNSKFTELYIMKQNIALDESLLQWKGWLNINQFIPNKAAAVGIKTYEICESQTGYLWRFKIHAHKASPTVSEADPFTASTPALVLNLIKGLEHKGYTLWMDNFYNSPALARKLKSIGFDCVGTLRTNRKYVPTELTNLKKSQMKPGQVVGYTSGDVDCIIWRDQNRVATISTYHGNAVSTKNGVTKLILIRDYNICMGGVDKKDQMLAAFPIERKRTQIWYKKLFKRRTQTGKCSAGRPRARWSDDLCRVAGRNWMSETEDRAQWRTIGEAHVQQWTAID

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

GO

Topology

Length:
597
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15071
Exp number, first 60 AAs:
0.05759
Total prob of N-in:
0.00646
outside
1  -  597
 
 

Population Genetic Test Statistics

Pi
183.726399
Theta
142.387758
Tajima's D
-0.64459
CLR
2.311419
CSRT
0.207739613019349
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号