SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08483
Pre Gene Modal
BGIBMGA007650
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_3-like_[Papilio_xuthus]
Location in the cell
Nuclear   Reliability : 3.825
 

Sequence

CDS
ATGGCAAATGACAGACCGTTAGCTGCGCATGAAATTTTAGATGCTTTAGAAAATGTTTCTGATAATGAAGAAGATTATAGAGAACGACTGATATGTATTCTACCTCCTCCTGTTGATCCTGACTGTCTCACTGACGAAGATTCGGGTGAAGAAGATAATGTAACTTTGAATAATTTGCCACGAAACATTCTGCTTCAACCGGCTGAAGTAATGATTCAAGGGCAGATTATGGTGAGTGATACAGAAGAACCTTCTGATTCTACAGATGTTCAAGGCGCTTGCCAAGATAAGCGCCCAATTGAGTGGTTTGAAAACTTCTTAGATGAAGATGTTATTTCGTTGTTGGTGTCAGAGAGCAATAAATATGCTGTCAAAAAGAATTTGCCTGGAGACATAACCACTGAAGATATGAAATGTTTCATCGGCATATTGTTGGTTAGTGGTTATTCATGGCTCCCCCGTAGAAGAATGTATTGGGAAAACTCCCCTGATACAAAGAATGAATTGATCAGCTCGGCTATGACTAGGGATAGATTTGACTTTATTTTTCGCCACCTTCATGTCAATGATAATCTGGATTTGCAAGACAAATACACAAAAGTACGCCCCCTAGTTACACTTCTAAATAAAAAGTTCTTAGAGTTTTCTCCTCTTGAAGAGCATTACGGTGTAGATGAGGCCATGATCCCCTACTATGGTAGACATGGCTGCAAACAGCACATAAAAGGTAAACCTATTAGGTACGGGTTCAAAGCTTGGGTTGGTGCTACACGGTTAGGTTTTTCTATGATGACGTCCAGGCAAGTATTTAGCGAAAGCGAGAAGACTTGCCTACAAGAATTAATTTTAAAATATAATCTGCACAAAACTGCTACCATGACAGCTAGTCAAAACACAAAAAAACTTTTGTGGATACATTTAACAGAAGAATTCAATTCAATTGAATCAAATGCAAAGCAAAGTGAGGCCCAGCTCAAGAAGTGCTGGGATAATTTAAAAACACGGAGGAAGCACTTTTTAGCTAATGAAAAGCGTCAGAGAATGAAGACTGGTGGCGGACAGTGTATTCCAAATGAGCCACAGCCTGGTAGCAGCAATGAGACCCTTATTTTTGCTGAGGTTCTACTGGATCAGACTGATGTGGAACTCAGGGGTGTCATTGACAGTGATACCATTTACAGTTCTGAAGGAAACGTTGCAGGCACCACGCCTATGCATTACACTCTATCATGTCGTGACACCCCACAACGTCGTGACACTCCACCATGTCGCGACACCCCAGCACGTCGTGACGCTCCTACAAGTCGTGACACTCCACCACGTCGTGACACTCCACCATGTAGCTACACCCCAGCACGTCGTGACACTCCACCATGTCATGACACTCCACCACGACGTGACACTCCACCACGTCGTGACACTCCACCACGTCGTGACACTCCACCAAGTCGTGACACTCCACCCAGTCGTGACACTCCACCCAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGCCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGTGACACTCCACCACGTCGTGACACTCCACCGCGTCGTTCTGGGTCCCGGCAGACTGACTGTGGTGCAGCCTCATTAGGAGGAGGGAATGTGCGCACCAGGGTAATTCAGGAGGAATTTAATTTTAGAAAAGAATCCTATGAAAAGAAAGAGAGAAGAGAAGACGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCAGAAGAAGTATATCTAAAAGCGAAGGCTGAGAGGGAAGCTGCAGAGGATATTAAAAAATATAATCAGGCTAAAAGAGAGGTGGCTGGCAAGAGCTGGATGAGGGAAGCCGAGGATTGTGCTCAGTGGCGAGCAATTGGAGAGGCCTATGTTCAGCAGTGGACTGCTGTAGGTTGA
Protein
MANDRPLAAHEILDALENVSDNEEDYRERLICILPPPVDPDCLTDEDSGEEDNVTLNNLPRNILLQPAEVMIQGQIMVSDTEEPSDSTDVQGACQDKRPIEWFENFLDEDVISLLVSESNKYAVKKNLPGDITTEDMKCFIGILLVSGYSWLPRRRMYWENSPDTKNELISSAMTRDRFDFIFRHLHVNDNLDLQDKYTKVRPLVTLLNKKFLEFSPLEEHYGVDEAMIPYYGRHGCKQHIKGKPIRYGFKAWVGATRLGFSMMTSRQVFSESEKTCLQELILKYNLHKTATMTASQNTKKLLWIHLTEEFNSIESNAKQSEAQLKKCWDNLKTRRKHFLANEKRQRMKTGGGQCIPNEPQPGSSNETLIFAEVLLDQTDVELRGVIDSDTIYSSEGNVAGTTPMHYTLSCRDTPQRRDTPPCRDTPARRDAPTSRDTPPRRDTPPCSYTPARRDTPPCHDTPPRRDTPPRRDTPPRRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPRRDTPPRRDTPPRRSGSRQTDCGAASLGGGNVRTRVIQEEFNFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNQAKREVAGKSWMREAEDCAQWRAIGEAYVQQWTAVG

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
666
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01095
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00091
outside
1  -  666
 
 

Population Genetic Test Statistics

Pi
368.350433
Theta
194.252857
Tajima's D
3.249882
CLR
0.401802
CSRT
0.989250537473126
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号