SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08480
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.158
 

Sequence

CDS
ATGGAAGAACTCAGTGAGAGTGTTATTAGTGACAGTGATTTTGTCGGGTTCCTCCGGGAAAGGTACCCGACAATTAGGGCCGAGTATGTTAGGTATAGGGCCTCTCGTGGCAATCCCTCTCCCCCCGCGTCCGTCGCCGCGTTTCTCAACCGTGCCTCGGAGGCACGCCGCGCGCCCCCCGCCGCCGCGTCAAGTTCGAGCGCACGTTCCCACGATGCGGCTCACGTAGCGCCTAACGCTACCCCCACCCCCGCGCCCGCGTCGAATACGTCATCTCGCGCTTCGTCCGTCGCGACCTCGATTGTTTCGAGTTCAGGCTCCGATACCGAATCGGAGATGGATTTCGAATCCGCGTCAAGCCCTCAGCCTGGAACTTCGGATGGGTTCCAAACCGTAACGCGCGGTAAAAAGCGTACTCGCGCCGTGGAGTCCCGGAGCTCCACGACGAAGCAGACAAAATCCGCGACCGCCTCCCGCCCGCAGGTAGTCGTGACACCGGAGTCGGACTCCGCTCGCCGCGTAACCCCGCCGCCGCGTCCCAAGCCCGCGCCCGCTCCTAAAGCAGCTGCCCCGCCCCCGCTGATTCTCCAGGAGAAAACTGCGTGGAACCGCGTTTCCCAGGCCCTTCAGGCAAATAAAATTAATTATACCCATGCGCGTAACGTCGCGCATGGGATTCAGATAAAGGTCGCAACGCCGGGCGACCATAGGGCCCTCTCAGCATACCTCCGAAAGGAGAACATAGGTTTCCACACCTATGCTCTTCAGGAGGACCGCGAGCTCCGCGTAGTAGTACGCGGAGTCCCCAAGGAGTTGGACATAGACTATGTTAAGGAGGATCTGACCGCTCAGGCCCTCCCGATAGTTAGTGTGCACCGGATGCACAGCGGGCGGGGCAAACAGCCCTATAATATGATACTCGTGGCGTTAGAACCCACCCCGGAGGCCAAAAAGAAGATCGCATGTCTCACGACAATTTGCGGCCTATCCGGGATCTCGATCGAAGCCCCCCATAAGCGTGGCACTCCCGGGCAGTGCTACAGATGTCAGCTTTACGGCCACTCGGCTCGTAATTGCCACGCGCGCCCCCGCTGCGTAAAGTGCCTCGGCGACCACGCCACACTAGATTGCTCGCGTGTTAGGGAAACCGCGACAGAACCTCCAAGCTGTGTCCTATGCCTTAAGCAAGGGCACCCCGCGAACTACCGTGGATGTCCTAGGGCTCCGCGAAAACGTCCGACCCACCCAGCCCCCCGAACCGTCGGCCCAAAGACTTCGGCGCCTTCAGTGCCGAAACCCGCCTTCGTGCCGGCTGCAGTTCCCACGGTGTCGGCGTGGAAAAAACCGCTGCCGTATACGAAGGCGGGAACGGAAACCGCACCCCCGCCCCCGCTCGTGACACGCCCCGCGCCCCAGCCCCTGCTCGCACCTCGCCCCGCGCCCGCGTTCCGTCCCCCGCAACCCTCTGCCGCCAACGACTTCGCGCTCGTGCGTGACTTCGTCACCGCGGTCAACTTCGACCGTCTGCGATCGTTCGCTGACGCTATCCGTAGGTCGGTAACCCCCGAACAGCGGCTCGCGGCCGCTTTCGATCACATGGACGTTTACGAGTCCGTGTCGCCATTCTACAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTCGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATCGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCCGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACTAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTAATGCAGCTCGGTCGCCCCCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACACCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCTATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCGATCACATATCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCGGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTCGTACGCCCTTCAGGCCAACCACCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTACAACCTAGGAAGGCACCCGGCTCCGACGGCATCCACAACCGCGCGCTTAAACTCTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGTATACATAAGCCGGGCAAACCGACAAACGAAACTTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGGCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTGATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATTTATAAACTGTACAACATGGGAGTGCCAGACAGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGTTATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACCGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATCGGCGACTCCAGATCGCAGTAGCCACCCTGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATTCCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGTCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGTAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACGCAGCCCGCACCAACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCTTGGTTCCTTAGGAATGTGGATCTCCACGACGACCTGGAGCTCGACTCTTTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGCAAGTCTTCTCGCTTTCGCTAAATACTTGCCTGGACGTCATCATAGAAAAACTGAAACGACAAATAATTTACTGCATCGTAATTTCACGTAA
Protein
MEELSESVISDSDFVGFLRERYPTIRAEYVRYRASRGNPSPPASVAAFLNRASEARRAPPAAASSSSARSHDAAHVAPNATPTPAPASNTSSRASSVATSIVSSSGSDTESEMDFESASSPQPGTSDGFQTVTRGKKRTRAVESRSSTTKQTKSATASRPQVVVTPESDSARRVTPPPRPKPAPAPKAAAPPPLILQEKTAWNRVSQALQANKINYTHARNVAHGIQIKVATPGDHRALSAYLRKENIGFHTYALQEDRELRVVVRGVPKELDIDYVKEDLTAQALPIVSVHRMHSGRGKQPYNMILVALEPTPEAKKKIACLTTICGLSGISIEAPHKRGTPGQCYRCQLYGHSARNCHARPRCVKCLGDHATLDCSRVRETATEPPSCVLCLKQGHPANYRGCPRAPRKRPTHPAPRTVGPKTSAPSVPKPAFVPAAVPTVSAWKKPLPYTKAGTETAPPPPLVTRPAPQPLLAPRPAPAFRPPQPSAANDFALVRDFVTAVNFDRLRSFADAIRRSVTPEQRLAAAFDHMDVYESVSPFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADTAPPILPYGPDSNLSPEDTVESINIITDHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIRMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLVRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKLLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPTNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDRLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHRRLQIAVATLGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHAARTNLKSLQVIQSRFCRIAVGAPWFLRNVDLHDDLELDSFSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMASLLAFAKYLPGRHHRKTETTNNLLHRNFT

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.000283209,     Score=110

Ontologies

Topology

Length:
1471
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.166840000000001
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00000
outside
1  -  1471
 
 

Population Genetic Test Statistics

Pi
184.489702
Theta
143.507063
Tajima's D
2.368975
CLR
0.555445
CSRT
0.929903504824759
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号