SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08479
Pre Gene Modal
BGIBMGA011802
Annotation
PREDICTED:_uncharacterized_protein_LOC101745617_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.726
 

Sequence

CDS
ATGTTGCAGGCACCACCTATGCATTACACTCTATCATGTCGTGACACCCCACAACGTCGTGACACTCCACCATGTCGCGACACCCCAGCACGTCGTGACGCTCCTACAAGTCGTGACACTCCACTACGTCGTGACACTCCACCCAGTCGTGACACTCCACCATGTAGCTACACCCCAGCACGTCGTGACACTCCACCACGTCATGACACTCCATCACGTCGTGACACTCCTCCACGTCGTGACACTCCACCACGTCGTGACACTCCACCAAGTCGTGACACTCCACCCAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCAAGTCGTGACACTCCACCACGTCGTGACACTCCACCGCGTCGTTCTGGGTCCCGGCAGACTGACTGTGGTGCAGCCTCATTAGGAGGAGGGAATGTGCGCACCAGGGTAATTCAGGAGGAATTTAATTTTAGAAAAGAATCCTATGAAAAGAAAGAGAGAAGAGAAGACGAACTCTTTCAATTCCAAAAAAAGGAAAGAGAGTGGATGATGAAGGCAGCAGAAGAAGTATATCTAAAAGCGAAGGCTGAGAGAGAAGCTGCAGAGGATATTAAAAAATATAATCAGGCTAAAAGAGAGTGTAGTGAAAAATAA
Protein
MLQAPPMHYTLSCRDTPQRRDTPPCRDTPARRDAPTSRDTPLRRDTPPSRDTPPCSYTPARRDTPPRHDTPSRRDTPPRRDTPPRRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPSRDTPPRRDTPPRRSGSRQTDCGAASLGGGNVRTRVIQEEFNFRKESYEKKERREDELFQFQKKEREWMMKAAEEVYLKAKAEREAAEDIKKYNQAKRECSEK

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
223
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.04171
outside
1  -  223
 
 

Population Genetic Test Statistics

Pi
191.628236
Theta
14.981033
Tajima's D
3.30655
CLR
1.086426
CSRT
0.990350482475876
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号