SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08470
Pre Gene Modal
BGIBMGA003541
Annotation
hypothetical_protein_ALC57_15604_[Trachymyrmex_cornetzi]
Location in the cell
Nuclear   Reliability : 2.855
 

Sequence

CDS
ATGTCAGAATATTGTTTTATTTGTACTCATCTTTTAACTGAAAGTGAAACTGTAACTGTTGATCGTGGTATGAAGACACTGATTAATGCAAGTGCTGAAAGAGATGATGGATACTCGGAATTTCTTAAAAAACAAAAATCTGTGACAATACATAGCAACTGTCGTAAAATTTATACGCGGAAGTGTTCTATTGCTGCTGCCATCAAAAGAAAACGCGAAGAACAAGAAGCTAACACATCTACAGGATCTACAGTAAGTAGTCCTCCTCGTACTAGATCCCGTTCAAGTGATTCAGCTTTTTGTTTTAAAAAACTATGTTTATTTTGTGGCAATAAATTGAATGAAGAGTTGCAGAGAAAAAAATCCTTAGATCGTCGCAGTAAAATTTGTCAAGTAAGTACACTCCAATTCAAACATTCAATTTTGGAAGTAGCACGAACTCGTTCCGATGCTATATCGAAAGCTGTTGTTGCTCGAATCGAATTTGACTATGATTTAGTTGCTGCTGAAGCAAAGTATCACCAAGAATGTTATACTTCTTTTTTGAAACCGACTACTGGCGGTACAGTTGGTCGTCCTAAAGATGAAGCAACAGATCTGGCAATGCAGGAAATATTTACATACATTGAGAGTAGCAATGACTGTCAGTTTACTTTGGCTGAGTTAAAAGATGTTAGCAAAATTTTAACTTTAGATAACAGGACTATTAAGCTGCGACTTAAACTGAAATATGGCGATAAAATTATTATCACTGAAAAACCGGGAGCGTTAACATTTGTATGTTTGATAAACAGTCACCATGAAATTTTAAATCAATCTTGGTCCGAAAATAAAAAAAATAATAAACAAGAAGAACGATTAAAAACTCTAGAAGCAGCAGCATCTATTATTCGAGAAGATATTCAATCCTCGGTATTTGATAATTCCTACTACCCTCCACCAGGTCGAATGTTTGAAGATTTAAATAATGACATCCCACAGTCACTGACATTTTTTTTGGAGCAAATGATCTTAAAAAATAAACGATCAAATTTCGATCATTTAAAACTAGTATGCACCAATATTTGTCATAGTATCATGACTGCTATTCGACCAAGATCGTTCAAGTCCAAATTACAGTTAGGTCTTTCAGTTTTTTTTCATCGGAGGTTCGGGTCTAAGCGTCTTATACAAATTTTGTCGTCTTTTGGTTTGTGTGCTTCTTATAATGATACATTGATGTACAAGTCAGCAGCAGTTTTTCATCCTCTTCCTCATGTCCTACCACCTGAAAGTGGCACACTTATTCAATACGTTGCAGATAATGCTGATATAAATGTTAATACGCTAGATGGTAACAATTCACTCCACATAATGGGTATAATTCAAATTGTAACTCCAAAGCACTCTGTTTTACTAGAAGAACCTATGCAACGAATAAAAGAAGTTCTTTCAGCAAAACACTTCAAAGCAAAAGCTCATGTGCCAATACAGATCTATCAGAATAGTGATGTAGTTGGTTACAGTAAAATATATGTCCAAGATTTTGGATATGGAACTGAAACAGTATCTTTTCATAAAAATTCTGATGTAGTATGGTTTTATGGAAAGTGGAAAAATACATCATTACCTGGTTGGAACGGTTTTATTGAGCGCTTAACAAATTACCATACAAATTATTCAAAATCTCAGATTACATTTTTACCATTCATCCATCAACCAGCTAGTAACTATAATACTGTCTATACGACTTTACTTTGTGCATTAGAGAACGCGAAACGTTACGGCCACACTGTATGCATCGTGACTTTCGACCAACCCTTGTATGCGAAAGCTCGAGAAATTGTATCAGCCGCACCTGACGGCTCTGAAGTATCGAAGATTATTGTCAGACTTGGAGGATTTCATCTACTCATGTCTTATCTCGGAGCAATTGGTTATATTATGCAAGGTAGCGGGATAAAAGAAGTACTCTCAGAAATCTATGCACCAAAGTCATTAGAAAAAATGCTCAATGGTCATGCTTACGCAAGAGCTGTTCGAGCACATACACTACTCCAGCTGGCTTTAGCAATTACAATATTAAAAACAATAGATATTAATGATATCATGGGAGCAGATTTAATCATAAATATTGACCATATATTAGATAGCACTCTTTCATATTCAGATATTGAAAATGATAATGAAGTATCAGGTGCTTTACTTCATAAATTTAATATGAAATTGAAAGATTTTGAGGAACGAGGACCAACAGCGCAACTTTGGATACAATATTTTAATATGGTTTCACTTGCAAAAGAATTTTTGAGAGCTGAGCGTATGGGGGACTGGAAAGCTCATTTAAGTTGTGTAAAAGAAATGTTACCTTATTTCCACTCGTCAGGACATTTTCCATATGCTAAATCTGCACACTTGTATTTACAAGACATGATGCAATTACAGGACTCGATGGATCCTGAAGTTTACGAAAAATTTACCGAAGGATTTTTCACCGTGAGACGCTCAGATAAATTGAGTTGTGGAACTTCTACAGACATGGTTATCGAACAGTCTATGATGAAAGCCATGAAGACAGATGGAGGTATTGCTCGAGGAAGAAGTACAAAACAAAGTGTAATCAGTAAATGGGTTTACAGCATGCATGCAATGAACACAGTTTGTGAGAAATTAGAAGATCTTGCTAATGTTAGGATGGATACGACTGAACAGCATGTTGATGCCAGTGATTCACGTGTAAAAAAAGACGCTAAAGACATACGAATGCTTCTTGAGTGGTTCTCGATTCATGATCCTTTCCCAGAGGTTAACAAAGTCATCTCGATTGCAAGTGGTGTCGTTGGTGATAATACAATTAATTGCTATAAAGCACGTGAACTTGGGCTTATCTCTATTGCTAAAATAACTGGACTGACATTTAAAGATATTAAACTTAAACGCGCTGACAAAGTTGTTCCTCTTTTAGCTATGAGTAGCACCGTAAAAGTTCACGAAGAAAAAGTACCTGTTGACCCAGTGTTATTATTCCAACGTATGAGTGTTACTGCGGCTTTTCAAGATGAAATTGAGAAATATTTCGAGTATGAATTAGCTCCTTATCCGTTAACATTATTTGATGACATTGGAATGCGCAAGACCCAGAAGTCGGCTATTTACGATTGTTTTCAGACTATAAATGTTGATATTAATAACACTAATTCAACGTACATAATTGACGGAGGATTCTTATTACATCGAGTGGTGTGGGATAGCGAGGAAACATTTAACGTTATCTTAGATAAATACGTTCAATATGTACGTCGACATTTTGGTTCCAGAGTTACTGTCGTATTTGACGGATATGATGATTATACGAGAAATATTAAAGCAGCAGAGCAACGCCGTCGAAATGCTGCTTCATCAACTTCTTCTGATATTATATTCGATGAATCAATGACAGTTCCTACCAGTCAACAGAAATTCTTTGCAAATAATCACAATAAATCTAGGTTTATTTCGATGTTGAAAGCAAAATTTACTGCTGAGAATATATCCGATGAACAAGCTAATGATGATGCTGATGTATTGATTATTGAAACAGCGATAAAGAAATTCAGTGTGACAAATACAACTGTTGTTGTTGGTGAGGATGTTGATTTACTCGTCTTGCTTACTGCTCGAACTCCAACTGAAAAAATTATTTATTTTTTTAAACCCGGAAAAGCCCAAAATCAATCGGAAATATATTCATCAAACAGTTTATCCAATTTTCCTAAATGTCAAAATCATGTATTGTTTCTACACGCAATAACTGGCTGCGATACGACATCTGCTTTTTACAGGAGAGGAAAAACAACAGTTTTCAAAATGTTTGAAAAAAAAGATTTACTACAATGTGCTGAAGTTTTTAAAAATAGTAATTCAACTCAACAACATGTTATCACCAACGGAGTTCAATTTCTTCTTGCTATGTACGGAGCCCCCAAAAAAACCACTTGCTTAGATAAGTTGCGATACACATCTTTCGTGAAAAATACGCGTAATAAAAAACAAGTCAACTTAGCTTCTCTTCCTCCAACCTCAGTAGCTGCTCATCAACATCTGTTTCGGGTATATTACCAAGTTCAAGTGTGGCTTGGTAATCAGCTGGACCCTAAAGACTGGGGTTGGAAGTTGATCGACAATACACTAGAGCCAGTTCAAACTTTACTTCCACCAGCACCTGAGAAACTTCTCAACACAATATTTTGCAACTGCAAGAAAGGGTGTAGTGCAAAATGTGGTTGCAGAAAAGTTGGACTGTTTTGTTCCCTGGCATGCACACACTGTCAAGGCCGATCATGCTCGAATGTTGAGTCACCAACTCTTGAAGATTCGTTTGATACCGATCAGGAATCGCTATTGGGGCAGTTTACGTGTGAAATAGAACAAGAAGAAGAAGAAGAACAAGAGGATGAACAGGAAGAAGAAGGAGAAGAAGATCAAGAAGAAGAAGAAACAGAAATCTTGGACAGTTATGAATCAGACGACTAA
Protein
MSEYCFICTHLLTESETVTVDRGMKTLINASAERDDGYSEFLKKQKSVTIHSNCRKIYTRKCSIAAAIKRKREEQEANTSTGSTVSSPPRTRSRSSDSAFCFKKLCLFCGNKLNEELQRKKSLDRRSKICQVSTLQFKHSILEVARTRSDAISKAVVARIEFDYDLVAAEAKYHQECYTSFLKPTTGGTVGRPKDEATDLAMQEIFTYIESSNDCQFTLAELKDVSKILTLDNRTIKLRLKLKYGDKIIITEKPGALTFVCLINSHHEILNQSWSENKKNNKQEERLKTLEAAASIIREDIQSSVFDNSYYPPPGRMFEDLNNDIPQSLTFFLEQMILKNKRSNFDHLKLVCTNICHSIMTAIRPRSFKSKLQLGLSVFFHRRFGSKRLIQILSSFGLCASYNDTLMYKSAAVFHPLPHVLPPESGTLIQYVADNADINVNTLDGNNSLHIMGIIQIVTPKHSVLLEEPMQRIKEVLSAKHFKAKAHVPIQIYQNSDVVGYSKIYVQDFGYGTETVSFHKNSDVVWFYGKWKNTSLPGWNGFIERLTNYHTNYSKSQITFLPFIHQPASNYNTVYTTLLCALENAKRYGHTVCIVTFDQPLYAKAREIVSAAPDGSEVSKIIVRLGGFHLLMSYLGAIGYIMQGSGIKEVLSEIYAPKSLEKMLNGHAYARAVRAHTLLQLALAITILKTIDINDIMGADLIINIDHILDSTLSYSDIENDNEVSGALLHKFNMKLKDFEERGPTAQLWIQYFNMVSLAKEFLRAERMGDWKAHLSCVKEMLPYFHSSGHFPYAKSAHLYLQDMMQLQDSMDPEVYEKFTEGFFTVRRSDKLSCGTSTDMVIEQSMMKAMKTDGGIARGRSTKQSVISKWVYSMHAMNTVCEKLEDLANVRMDTTEQHVDASDSRVKKDAKDIRMLLEWFSIHDPFPEVNKVISIASGVVGDNTINCYKARELGLISIAKITGLTFKDIKLKRADKVVPLLAMSSTVKVHEEKVPVDPVLLFQRMSVTAAFQDEIEKYFEYELAPYPLTLFDDIGMRKTQKSAIYDCFQTINVDINNTNSTYIIDGGFLLHRVVWDSEETFNVILDKYVQYVRRHFGSRVTVVFDGYDDYTRNIKAAEQRRRNAASSTSSDIIFDESMTVPTSQQKFFANNHNKSRFISMLKAKFTAENISDEQANDDADVLIIETAIKKFSVTNTTVVVGEDVDLLVLLTARTPTEKIIYFFKPGKAQNQSEIYSSNSLSNFPKCQNHVLFLHAITGCDTTSAFYRRGKTTVFKMFEKKDLLQCAEVFKNSNSTQQHVITNGVQFLLAMYGAPKKTTCLDKLRYTSFVKNTRNKKQVNLASLPPTSVAAHQHLFRVYYQVQVWLGNQLDPKDWGWKLIDNTLEPVQTLLPPAPEKLLNTIFCNCKKGCSAKCGCRKVGLFCSLACTHCQGRSCSNVESPTLEDSFDTDQESLLGQFTCEIEQEEEEEQEDEQEEEGEEDQEEEETEILDSYESDD

Summary

Pfam
PF03564   DUF1759        + More
PF05585   DUF1758
Interpro
IPR005312   DUF1759        + More
IPR029060   PIN-like_dom_sf       
IPR008737   Peptidase_asp_put       
IPR007527   Znf_SWIM       
IPR036691   Endo/exonu/phosph_ase_sf       
SUPFAM
SSF88723   SSF88723        + More
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
1496
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.13256
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00091
outside
1  -  1496
 
 

Population Genetic Test Statistics

Pi
156.352053
Theta
158.772263
Tajima's D
-0.904312
CLR
20.852715
CSRT
0.156842157892105
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号