SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08428
Pre Gene Modal
BGIBMGA011163
Annotation
PREDICTED:_intracellular_protein_transport_protein_USO1-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.702
 

Sequence

CDS
ATGTCGTTGTCACCTGAGATGTCACTGCTTTTATCTAAAATGACGGAACAATTGAACTTGCAAACTGCTACAATTACGGAAAATATAACTGCAGCCATATTACACCAAGTCGACGAAAAAATAAAACCGATCATAGAGGAGAACGAAAAACTGAAGCAGGAAGTTGAGACATTAAACAAAAAGATTCTTACCCTCGCGTCTATTACCAGGAAAAACAATATATTAATTCATGGCTTACCTGAAGAAAATGATGAAAAATTCGAAGATCTAAGTAACCTTGTAAAATCAACATTGCGCGGAATCGAAGTGGAAATTAAAACAGAAGATATTAACATACTTCAGAGACTAGGGAAAAAAGGATCCAGAGATGGCAAAACTAGACCAATTTTGCTTGCTACCACGAGCCTACAGAAGAAAATCCAGATTTTGAAAAATAAAAAGAAATTGAAAGCTGACATATACATCACGCACGATCTACCAAAGGAAGTACTTCTAGCCAAGAAAGGAAATAAAAACAAAAATTCCGGCGACAGCAAAAAAGACACAGAAAAAAGGAAAAGATCTGAAACTCCAAGTCCTGGCAACCCAATTGCAACAAATACGAAGATGCACAAGATAGATGCTTTTCAATACTTACGACAGAGATCACACTCCTTTTCAGAAAAAAACACAAACAAAAACTAA
Protein
MSLSPEMSLLLSKMTEQLNLQTATITENITAAILHQVDEKIKPIIEENEKLKQEVETLNKKILTLASITRKNNILIHGLPEENDEKFEDLSNLVKSTLRGIEVEIKTEDINILQRLGKKGSRDGKTRPILLATTSLQKKIQILKNKKKLKADIYITHDLPKEVLLAKKGNKNKNSGDSKKDTEKRKRSETPSPGNPIATNTKMHKIDAFQYLRQRSHSFSEKNTNKN

Summary

Pfam
PF14529   Exo_endo_phos_2
Interpro
IPR004244   Transposase_22        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR027124   Swc5/CFDP2       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
227
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00044
Exp number, first 60 AAs:
0.00044
Total prob of N-in:
0.00711
outside
1  -  227
 
 

Population Genetic Test Statistics

Pi
233.587314
Theta
124.576446
Tajima's D
2.722269
CLR
0
CSRT
0.96275186240688
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号