SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08426
Annotation
reverse_transcriptase_[Anopheles_gambiae]
Location in the cell
Mitochondrial   Reliability : 1.612 Nuclear   Reliability : 1.487
 

Sequence

CDS
ATGCGCGCCCACTTTGGGGCTGTGGGGGGAGAAACAGGCGGCACAGGGCGTCGAGCAAGACTGCTTCGTAATTTTCAAGCGCTTGAGCCATCGCTGACACACATCACAGACCAGAACCTAGCCGACCGAGTTCGTTTCATAATGCGCTCTAACATCTTCAGCGCAAACGAACTCGAACAACTACGACTCGAGGCTGTTCCGGCCTCCTCTCTTGCACCAGCTGAAGGACGTGTGTCTATCGCATCTATGCAGGACTTAAATGTCGGCGGTGCGGTAGACACTGGTTATCAACCATTGGCTGCTGACGGAGGGGCGGACGGAATAGCTTCCCAGGACAACGAGCAGATCAGGAGGATTCTTGAAGAGGCGATTCTGGAAGTGCGTGAGATGCCTCTCGACGCGAGACCCCGGATCCCCAGAATAGCTCAGAGTCACCATAGTCGGAATGTCGTTGAGGCCGTTAACGAGATGCTGCTTCCATATTTGGAGAACAGCAGCAGCCTCACTGAAACGAATTCAATCCTGTTTGGCGCCGCAATGGCAGTATGTCGGTATATCGGCGCCAAGCTCCAGCCAAATCGGCAGGTGACAGCTGCCGACGCTCAGCGTGTGAGAGAAGCCGAGCCTGCTTGGAAGCGCAGAATTGAACGTCGTATCAGTGACGCTAGAGTCCTTATCGGCAAACTGATTAGCTTCAGGACGGGCAACACGAGGCCGAGAGTCTTGCGGTTTGTCAGAATTGCGTTTGCGGGGTGTGGCTTAGGCCCTGCAGTGCCAAATGCACAACAGCTGGCAGATCGCATAGACCTCCTGAAGCAGAAGGTGGCTGCTTGGAGCAAGCGCATCCGGCGGTACTCGGAACGAGTTCAAAGGTATCGCCAGAATCGCCTCTTCGTGAGTGATCAGAGGAAGTTCTACAGGTCCCTAGAACAGGCCAATGTTAGCGCCGTCACCGAACGTCCAGCTGGACAGGAGATGGTCACATTCTGGCGTAACTTGTGGTCAAGACCTGTGGAGCATGTGGAGGGCTCCTGGATGCAGGTCATTGAGGACTCGTGTGCGGGCATACCACCGATGAGCCCGGTTACTATCAGCAAAGGTGATATTAAGGCTGCAGTCTGTAGTTCTTCACACTGGAAGTCTCCAGGCTGCGACGGACTGCAGCTTTACTGGCTAAAAAGTTTCCGGGCTTGTCACGAAACCCTCGCCAGACAGTTCCAGGAAGCCCTAGATACAAAAGTGCTCCCCGCCTTCCTCACTACTGGGATCACTCACCTCATTCCAAAATCGGAAAGTACCGCGGATCCGGCACAGTACCGGCCAATAACGTGTCTTCCTACCACCTATAAGACACTGACATCCGTTCTGGAAACTAAGATCTCACACCACATAGACAGCTGTCGAGTACTGTCTGGTGCCCAGAACGGGTGTAGGCGTGGTAGCCGCGGTACTAAGGAACTCCTCTTGATCGACGCGGTAGCTGGCCAGCAGGTCAAACGCAACCGACGAAATTTCTCTGCCGCCTGGATAGATTATAAAAAGGCATTTGACTCGGTCCCCCATACATGGCTGAAGAGGGTCCTCGAGCTGTATAAGATAGACGATACAGTTCGAGACTTCCTCGGTGCCTGTATGGGGCAATGGAGTACAATGCTTAGTCTATCCGGTGTGCGGCTGTCGGCTGTAGAAGACCGAATAAAGGTGAATCGGGGTATATTTCAGGGTGATTGTCTGAGTCCATTGTGGTTTTGCCTGGCCCTGAATCCTCTCAGTTCATTACTGGAGGCTTCGAGGACAGGCTTTCAGTTCCGAAGGGGGGGCTTGAAGGTGTCCCACTTGTTCTACATGGATGACCTCAAGTTGTACGCTCCTCATGCTGCAGGCCTCAGGCGACTGCTTGACATCACTTGTGATTTCAGTAGTCGCATTAGGATGAGGCTGGGAGTCGACAAGTGTGCGGTTCTCCATGTAGAGAGAGGGAGCATAGTCTCATCGGATCGTTTACCTGTATCCGATGGGATAAACCTTCGGGCACTCTCCGAGGGAGAAACATACCGGTACCTGGGCATGTCGCAAAATTTAGGTATTGACGTGGCGGTCGTCAAACAGGCTGCATGCGACGTGTTTTGTGAACGTTTGACAAAAGTGTGTAAGAGCCTTTTGTCGGGCGTGAATAAGACAAGGGCGTTTAACGGCTGGGCGATGCCCGTCCTGTTGTATACCTTCGGCGTGCTCAGGTGGACTCTGACCGAACTGGATGCCCTGGATAGAAAAGTCCGCTCAATTATGAACCTCCATAGGATGCTCCACCCGAAGTCCTCGGTAATGAGATTGTACATTCCGCGGAAGTGTGGTGGCCGGGGCCTACTTAGCGCCAAGGTCATGCACAACAGTGGGGTGTGCAGTCTCAGGGAATATTTCCTATCGAGGGCTGACAGTGTGATGCACAGAGAGGTCATGGAATGCGACAAAGGACTGACCCCGCTAGCCCTGGCCAGAGACGGGTGGCAATCACCGGCGGTACTCAGTACCTCTGACCGTGAGGCCATATGGAAAGGGAAAGAGCTGCACGGACGCTTCTTTCAGGCACTGCATGAGCCCCACGTGGACAAAGAAGCCTCCGTGCACTGGCTGCGATTCGGTGACCTCTTTGGGGAAACCGAGGGTTTTGTCTGTGCAATACAGGATCAGGTTATCAGGACGAACAACTATAGGAAGCACATTCTGAGGGATGGGACAGCTGACATCTGTCGATTATGCCGCCGACCGGGTGAATCCCTCAGACATGTCACCTCTGGTTGTTCTATGCTTGCTAACACTGAGTACTTGCACAGACATAACCAAGCAGCCAGAATCCTCCACCAAGAGCTCGCCCTTAAGTATGGCCTCATCGAACAGAGGCTACCGTATTATAAGTACCAGCCGGACGCTGTACTCGAAAACGACCGTGCCAAGCTCTACTGGGACCGGCCCATCATTACGGACAGGACTATTCTTGCGAATAAGCCTGATATCGTGCTGATGGACCAGACGGAGTCTCGGGTATTTCTGGTGGATATCACCATCCCCTACGACGAGAACCTCGTGCGGGCCGAGGCAGATAAAAAGACCAAATATTTGGACCTGGCGCACGAGGTGACCGACATGTGGAGGGTGGTATCTACAGAAATAATCCCGGTAGTTGTGTCGGTGAATGGTTTGGTCCCTAAAAGCCTCTCAAAACATCTCGAGAGGCTTGGTCTCAACAAAAAGTCGGTGGTGGCCCAAATGCAAAAGGCAGTCTTGCTCGATAATGCCCGTATAGTTCGCCGGTTTCTCTCCCAATAG
Protein
MRAHFGAVGGETGGTGRRARLLRNFQALEPSLTHITDQNLADRVRFIMRSNIFSANELEQLRLEAVPASSLAPAEGRVSIASMQDLNVGGAVDTGYQPLAADGGADGIASQDNEQIRRILEEAILEVREMPLDARPRIPRIAQSHHSRNVVEAVNEMLLPYLENSSSLTETNSILFGAAMAVCRYIGAKLQPNRQVTAADAQRVREAEPAWKRRIERRISDARVLIGKLISFRTGNTRPRVLRFVRIAFAGCGLGPAVPNAQQLADRIDLLKQKVAAWSKRIRRYSERVQRYRQNRLFVSDQRKFYRSLEQANVSAVTERPAGQEMVTFWRNLWSRPVEHVEGSWMQVIEDSCAGIPPMSPVTISKGDIKAAVCSSSHWKSPGCDGLQLYWLKSFRACHETLARQFQEALDTKVLPAFLTTGITHLIPKSESTADPAQYRPITCLPTTYKTLTSVLETKISHHIDSCRVLSGAQNGCRRGSRGTKELLLIDAVAGQQVKRNRRNFSAAWIDYKKAFDSVPHTWLKRVLELYKIDDTVRDFLGACMGQWSTMLSLSGVRLSAVEDRIKVNRGIFQGDCLSPLWFCLALNPLSSLLEASRTGFQFRRGGLKVSHLFYMDDLKLYAPHAAGLRRLLDITCDFSSRIRMRLGVDKCAVLHVERGSIVSSDRLPVSDGINLRALSEGETYRYLGMSQNLGIDVAVVKQAACDVFCERLTKVCKSLLSGVNKTRAFNGWAMPVLLYTFGVLRWTLTELDALDRKVRSIMNLHRMLHPKSSVMRLYIPRKCGGRGLLSAKVMHNSGVCSLREYFLSRADSVMHREVMECDKGLTPLALARDGWQSPAVLSTSDREAIWKGKELHGRFFQALHEPHVDKEASVHWLRFGDLFGETEGFVCAIQDQVIRTNNYRKHILRDGTADICRLCRRPGESLRHVTSGCSMLANTEYLHRHNQAARILHQELALKYGLIEQRLPYYKYQPDAVLENDRAKLYWDRPIITDRTILANKPDIVLMDQTESRVFLVDITIPYDENLVRAEADKKTKYLDLAHEVTDMWRVVSTEIIPVVVSVNGLVPKSLSKHLERLGLNKKSVVAQMQKAVLLDNARIVRRFLSQ

Summary

Pfam
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001611   Leu-rich_rpt       

Ontologies

Topology

Length:
1108
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19277
Exp number, first 60 AAs:
0.00018
Total prob of N-in:
0.00229
outside
1  -  1108
 
 

Population Genetic Test Statistics

Pi
339.64061
Theta
173.371859
Tajima's D
1.884382
CLR
251.737411
CSRT
0.862656867156642
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号