SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08422
Pre Gene Modal
BGIBMGA009311
Annotation
PREDICTED:_uncharacterized_protein_K02A2.6-like_[Crassostrea_gigas]
Location in the cell
Nuclear   Reliability : 3.16
 

Sequence

CDS
ATGGATTCGTTAAAACCACCGCCACCATTATGCCTCATGGGCGACTTGAAACAAAATTTTCAAAAATGGACACAGCAATATGATATTTATATGATTGCTAGCGGGACGGAAGGTGATGAAAAAATTAAAGATAAGCAGAAAAAGGCAATCTATTTGCACTGCCTAGGTGCAGAAGCACTAACCATATACAATGGTTTTAAGAACAAAGAAAAGTTATCTTATGTGGAAGTAAAACAGAAGTTTAATGAATATTGTTCGCCACCCGGAAATGAAACTTTTAGTAGACATGTCTTCTTCAGCAGAAAAAAGAGAGATGGAGAAAGTTTTGATGAATTTTTCTGTACGTTGAGAAAATTGGCGGGAGACTGTGGGTTTGCAGACCTAGAAGAAAGCTTAATAAGAGACCAAATCATATTAGGCTTAAATGATGCCAAATTAACAGAAAGATTGCTTAAGGAACCGACCTTAACATTGGATAGCTGCATGAAAATATGTAAAGTGGCTGAGAGTGCTGCAAAACAGGTTCAAGTCATGACAGAAAAGACAGTTGAAGCTGTTACAAGAAAACAAGAATCTCGAAGCAGAATGCCTAATCAGAATAAAACCAGTTTTAATAATAAACAACATCTAGGTAAGAGTGCAGAAGGATCAGTAAGGTTGAAGAATAATAATTGTGAAAGATGCGGAGGAGTGCATTCTCATCGATCCTGCCCAGCCTTTGGAAGGAGATGTGCTAAGTGTAATCGATATGGACATTACATGCAGATGTGCAGAACAGTTGGTGCTGTGTATGTCAGCGATGATGATAGTGATGACTCATTAGTAGTGGGGTCAGTAACTGTGGGCCAGGTTGATACAGAGGACTGGATCGTTGAGGCAAAAGTGAGAGGACAGAAGATGAAGTTCAAAGTGGATACAGGATCGCAGGTTAATATTTTGACTAGTGCTATAGTGAAAAAACTAGACTTAAAAATGACAGAAACTTGTACAAAATTAAAAAACTTTGATGGCTCAACTATAGAAACAGTAGGTATGACTAAAACTATAGTGAAATTCAATAAAAAAAAATATGTACTTGACTTTTATGTGGTAAAATTTAAAACTACTAATGTGCTGAGCTATAAAGCTGCTGTGCAGTTGGGTTTAATAAACAAAGTTGAAAATATTTCAAAGGAATATGTAGTTCAGGACATTGGTGAATACAAAGATTTGTTTCATGGCTTAGGAAAATTGAACTATGTATACAAAATTAAATTAACAGACAATTGTGCACCTATAGTGGAGCCACCAAGGAAAATTCCTTTTAAATTAGTAGATAAAGTAAAAAATGAGCTTGATCGATTGGAGCAACTTGATGTAATAAAGAAAGTGCAAGAACCAACTGAGTGGGTTAACTCTATGGTGATTGTAAAAAAAAGTCAAGATAAAATTAGATTGTGTTTAGATCCACAAAATATAAACAAATGTATCATTAGAGAACGTCATAAAATACCTACCTTTGAGGAACTTACTTCAGCCATGCCTGATGCCAAATATTACTCAGTGTTAGATGCAAACAAAGGATTTTATCAGATTTTGTTAGCAGAAGAAAGTCAACTGCTAACAACGTTCAATGCAGGTCAATTTGGAAGATATTGTTTTAAGCGGTTACCATTTGGCCTGAATTCTGCCCCTGAGGTATTTACTAAGTGTTATTCAGAAATTTTCAATGATATACAGGGTGTAGTAACTTATGTTGATGAAATATTAGTATGGGGAGATACGAAAAAAACACATGATGAAAGATTACTCCAAGTTTTAGAAAAGGCTCGGCAGGCTGGGGTCAAGTTTAATAAAGAGAAATGTGTCATAGGTGTAAAAGAGGTTAAATATGTGGGTCATATCCTATCTAGTGAGGGCCTTAAGCCAGACCCAGAAAAAGTGCGAGCTATTGTGGACATGAAAGAGCCAACAACAAAAAAGGAATTACAAACTGTCTTGGGTATTATAACATACATTTCTAAATTTATACCAAATACATCAGAATTGACAGAATCACTAAGACAATTGCTAAAAAAAAACGTAGAGTACATTTGGGGTGACAAACAAAAAGAAGATTTTAAAAAAATAAAACAATTTCTCACTAGTGCAACAGTGCTCAGATACTTTGATGTCAACAAACCAGTGACTCTTTCAGTCGACAGTAGTTCCACAGGGTTGGGAGCGGTACTCCTACAGGATAATTTACCAGTTGCTTATGGGTCAAAGACCTTGACAGAGTGCCAAAAGTCATGGGCACAAATTGAAAAAGAAATGTTGGCAATAGTATATGGATGTGAAAAGTTTCATCAATATATTTATGATAAACATGTAATAGTTGAATCTGATCATAGGCCTTTAGAATACATATTTAAAAAAACAATCAATGAAACTCCACTAAGACTACAAAGGCTTAGATTGAGAATTCAAGGGTATGACCTGGAAATAAGATATAAACCAGGAAAAGAATTATTTGTAGCTGACGCCTTGTCTAGGAATAGCTTACCAGACAAAATATGTAATAAAGATTTGGATCAGCATGTAGAATTGCATGTTTGCTTGATAACGGAAGGATTAAAATTCACAGAACAAAAATTAGAAGATTTTAAAAAAAAAACTGCAAATGATGAAGAATGTCAAAAAATTATAAAAAATATTGAAATGGGATGGCCAGATAAAGTAAAATTACCAACAGATTTAAAATATTATCATTCTATAAAAGAGGATTTGTATTATGCAAATGGAAAGATATTTATATGGCCTTGA
Protein
MDSLKPPPPLCLMGDLKQNFQKWTQQYDIYMIASGTEGDEKIKDKQKKAIYLHCLGAEALTIYNGFKNKEKLSYVEVKQKFNEYCSPPGNETFSRHVFFSRKKRDGESFDEFFCTLRKLAGDCGFADLEESLIRDQIILGLNDAKLTERLLKEPTLTLDSCMKICKVAESAAKQVQVMTEKTVEAVTRKQESRSRMPNQNKTSFNNKQHLGKSAEGSVRLKNNNCERCGGVHSHRSCPAFGRRCAKCNRYGHYMQMCRTVGAVYVSDDDSDDSLVVGSVTVGQVDTEDWIVEAKVRGQKMKFKVDTGSQVNILTSAIVKKLDLKMTETCTKLKNFDGSTIETVGMTKTIVKFNKKKYVLDFYVVKFKTTNVLSYKAAVQLGLINKVENISKEYVVQDIGEYKDLFHGLGKLNYVYKIKLTDNCAPIVEPPRKIPFKLVDKVKNELDRLEQLDVIKKVQEPTEWVNSMVIVKKSQDKIRLCLDPQNINKCIIRERHKIPTFEELTSAMPDAKYYSVLDANKGFYQILLAEESQLLTTFNAGQFGRYCFKRLPFGLNSAPEVFTKCYSEIFNDIQGVVTYVDEILVWGDTKKTHDERLLQVLEKARQAGVKFNKEKCVIGVKEVKYVGHILSSEGLKPDPEKVRAIVDMKEPTTKKELQTVLGIITYISKFIPNTSELTESLRQLLKKNVEYIWGDKQKEDFKKIKQFLTSATVLRYFDVNKPVTLSVDSSSTGLGAVLLQDNLPVAYGSKTLTECQKSWAQIEKEMLAIVYGCEKFHQYIYDKHVIVESDHRPLEYIFKKTINETPLRLQRLRLRIQGYDLEIRYKPGKELFVADALSRNSLPDKICNKDLDQHVELHVCLITEGLKFTEQKLEDFKKKTANDEECQKIIKNIEMGWPDKVKLPTDLKYYHSIKEDLYYANGKIFIWP

Summary

EMBL
MRZV01000033    PIK61397.1    MRZV01000576    PIK47528.1    ABLF02013930    ABLF02013934    + More
MRZV01000618    PIK46835.1    GGMR01000868    MBY13487.1    HADY01023773    HAEJ01006887    SBS47344.1    GEZM01016880    JAV91071.1    KK112400    KFM57554.1    ABLF02022355    ABLF02022359    ABLF02022361    ABLF02022365    ABLF02041467    GCES01096219    JAQ90103.1    GBHO01022049    GBHO01022048    JAG21555.1    JAG21556.1    GBBI01004745    JAC13967.1    GEZM01066276    JAV68015.1    GBHO01036465    JAG07139.1    MRZV01002352    PIK33923.1    GBHO01004090    JAG39514.1    GDHC01013957    JAQ04672.1    GEZM01035137    JAV83383.1    AERX01070080    GEZM01041944    JAV80090.1    GCES01104253    JAQ82069.1    GEGO01004116    JAR91288.1    HADZ01002490    HAEA01007842    SBQ36322.1    GEZM01102055    GEZM01102054    GEZM01102053    GEZM01102051    JAV52011.1    GEZM01051395    JAV74977.1    HAEH01020882    SBS11479.1    ABLF02041541    GGMR01004179    MBY16798.1    HAEH01000697    SBR65395.1    HAEF01001580    SBR38962.1    GEGO01004317    JAR91087.1    GBGD01000115    JAC88774.1    GDIP01239061    JAI84340.1    GDIP01203362    JAJ20040.1    GDIP01199810    GDIP01181260    GDIP01124130    GDIP01104931    GDIP01053137    GDIP01051184    JAL98783.1    GBGD01000119    JAC88770.1    GDIP01073678    JAM30037.1    GDIP01019161    JAM84554.1    GDIP01102077    JAM01638.1    GDIP01156216    JAJ67186.1    NIVC01000291    PAA86189.1    GEZM01001973    JAV97431.1    GDIP01096578    JAM07137.1    KF319019    AIE48224.1    ABLF02019772    GEFM01002416    JAP73380.1    GGMR01014455    MBY27074.1    KK122208    KFM82237.1    ABLF02066184    ABLF02066704    GBHO01011825    JAG31779.1    GDKW01000526    JAI56069.1    GBHO01042421    GBHO01026477    JAG01183.1    JAG17127.1    GCES01115952    GCES01090369    JAQ95953.1    GEGO01004841    JAR90563.1    GBBI01004851    JAC13861.1    GCES01030230    JAR56093.1    GBBI01004852    JAC13860.1    GEGO01003204    JAR92200.1    GEZM01011167    JAV93617.1    HADZ01020631    HADZ01021503    HAEA01008283    HAEA01008803    SBP84572.1    SBP85444.1   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF00078   RVT_1
PF00665   rve
PF03732   Retrotrans_gag
PF09668   Asp_protease
Interpro
IPR001584   Integrase_cat-core        + More
IPR041577   RT_RNaseH_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001995   Peptidase_A2_cat       
IPR005162   Retrotrans_gag_dom       
IPR001969   Aspartic_peptidase_AS       
IPR019103   Peptidase_aspartic_DDI1-type       
IPR036875   Znf_CCHC_sf       
IPR000679   Znf_GATA       
SUPFAM
SSF50630   SSF50630        + More
SSF53098   SSF53098       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=7.26528e-47,     Score=476

Ontologies

Topology

Length:
927
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01112
Exp number, first 60 AAs:
0.00727
Total prob of N-in:
0.00061
outside
1  -  927
 
 

Population Genetic Test Statistics

Pi
63.077844
Theta
164.889099
Tajima's D
-1.474951
CLR
0.203889
CSRT
0.063896805159742
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号