SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08418
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
ATP-dependent DNA helicase      
Location in the cell
Cytoplasmic   Reliability : 1.065 Mitochondrial   Reliability : 1.333 Nuclear   Reliability : 1.303
 

Sequence

CDS
ATGCTCGGTAGTTCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCAGCGAAGGTGTAGTTCGAGCGCGAAGGCTCCACTCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCACGACGAGGAAGACACAGCGGAACACACGCTGGCGCGTTGCTCTGGATTCGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGTGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGAGGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATCTCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MLGSSPWDLEAEALAADYRWRSDLRSRGEGRPSEGVVRARRLHSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADHDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSEASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Catalytic Activity
ATP + H2O = ADP + H(+) + phosphate
Cofactor
FAD
Mg(2+)
Similarity
Belongs to the GMC oxidoreductase family.
Belongs to the helicase family.
EC Number
3.6.4.12
EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150308    PZC71477.1    + More
KZ150386    PZC71062.1    LBMM01009501    KMQ88083.1    LBMM01016102    KMQ84557.1    LBMM01012027    KMQ86470.1    KZ149950    PZC76665.1    RSAL01000109    RVE47213.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078935    BAC06462.1    LBMM01006538    KMQ90523.1    KZ149896    PZC78733.1    AB078929    BAC06452.1    RSAL01000009    RVE53812.1    RSAL01003504    RVE40273.1    ODYU01005282    SOQ45985.1    ODYU01009945    SOQ54696.1    RSAL01000481    RVE41577.1    QOIP01000009    RLU18544.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    RSAL01000014    RVE53298.1    LBMM01008861    KMQ88580.1    RSAL01001432    RVE40790.1    LBMM01014132    KMQ85305.1    LBMM01003679    KMQ93242.1    D85594    BAA19776.1    LBMM01009494    KMQ88097.1    KQ460685    KPJ12887.1    LBMM01003452    KMQ93523.1    QOIP01000010    RLU18098.1    LBMM01006662    KMQ90413.1    LBMM01006725    KMQ90373.1    QOIP01000031    RLU14697.1    LBMM01019838    KMQ83439.1    LBMM01006110    KMQ90925.1    LBMM01019839    KMQ83438.1    LBMM01006671    KMQ90407.1    QOIP01000002    RLU25407.1    LBMM01008349    KMQ88951.1    LBMM01007088    KMQ90053.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF01421   Reprolysin
PF00732   GMC_oxred_N
PF07776   zf-AD
PF00096   zf-C2H2
PF05970   PIF1
PF00059   Lectin_C
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR036188   FAD/NAD-bd_sf       
IPR012132   GMC_OxRdtase       
IPR000172   GMC_OxRdtase_N       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR016187   CTDL_fold       
IPR010285   DNA_helicase_pif1-like       
IPR016186   C-type_lectin-like/link_sf       
IPR001304   C-type_lectin-like       
IPR018378   C-type_lectin_CS       
IPR027417   P-loop_NTPase       
SUPFAM
SSF56219   SSF56219        + More
SSF51905   SSF51905       
SSF57667   SSF57667       
SSF52540   SSF52540       
SSF56436   SSF56436       
PDB
4XVM     E-value=0.0607302,     Score=81

Ontologies

Topology

Length:
216
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00222
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01113
outside
1  -  216
 
 

Population Genetic Test Statistics

Pi
135.300779
Theta
74.186859
Tajima's D
1.796541
CLR
0.000695
CSRT
0.850157492125394
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号