SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08417
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.286
 

Sequence

CDS
ATGCGCGTGCGCGCCCTCTCTGATGAGGCTGTCAGCCGGGGCGGGGTTGCACTGGCGGTGTCCCTGGACATCGCCAATGCGTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGCAGTATCACGGCGTCCCTGCGTATCTCCGTCGGCTGATCGGGTCCTACCTCGAGGATAGGTCGGTCGTGTGCACCGGGCACGGTGGGACGGTGCTCCGCTTCCCCGTCCAGCGCGGTGTTCCACAGGGGTCGGTCCTTGGCCCTCTCTTGTGGAACATCGGCTACGACTGGGTCTTGCGTGGCACCCTAAGCACTCCTCTCCCGGGTCTGAGCGTAGTTTGCTACGCGGACGACACTTTGGTCGTGGCCCGGGGGAGGGACTTGCGAGAGTCTGCCCGTCTTTCCTGCGCGGGGGTGGCCTTCGTCATCGGCAGGATCCGACGGTTGGGTCTGGAGGTGGCGCTTGATAAATCCCAGGCCCTGTTGTTTCACGAGGCCCGGAGAGCGCCGCCTCAGGGGGCCCACCTCGTGATCGGAGGCGTTCGCGTCGAGATCGAGGCAACCGGGTTGCGGTACCTCGGTCTCGTACTGGACGGTCGTTGGAGCTTTCGCGCTCACTTTGAAAGATTAGGTCCCCGACTGATGGCGGCCGCCGGCTCGCTGAGTCGGCTGTTGCCGAACGTCGGGGGGCCTGACGTGGTGGTGCGCCGCCTCTACACGGGGGTGGTGCGGTCGATGGCACTGTACGGGGCTCCCGTGTGGTGCCACGCCCTGACCCGCGACAACGTTGCGGCGTTGCGACGTCCGCAACGCGCGATTGCGGTCAGGGCGGTTCGTGGATACCGTACCGTCTCGTTCGAGGCGGCGTGCGTGCTAGCTGGGACGCCTCCCTGGGACCTGGAAGCGGAGGCGCTCGCTGCGGATTACGCGTGGCGATGCGATCTCCGCTCCAGGGGGGAGGCGCGTCCCGGCGCGGCGGAAGTTCGAGCGCGGAAGCTTCAATCTCGGCGTGCCGTGCTCGAGGCGTGGTCTCGCCGCCTGGCGGACCCCGCCTACGGGCGACGGACCGTCGAGGCGATCCGCCCGGTCCTCTCGGACTGGGTGAATCGCGACCGAGGACGTCTCACCTTCCGAGCGACGCAGGTGCTCACGGGACACGGCTGTTTCGGTCGCTACCTACACCTCGTCGCCCGGAGGGAGCCGACGCCGAAGTGCCACCACTGCAGTGGCTGCAACGAGGACACGGCGGAGCACACGCTCGCGTACTGCACCGCTTTCGCGGAGCAGCGCCGCGTCCTCGTTGCAAAAATAGGACCGGACTTGTCGCTTCCGACCGTCGTGGCTACGATGCTTGGCAGCGACGAGTCCTGGCAGGCGATGCTCGACTTCTGCGAGTCCACCATCTTGCGGAAGGAGGCGGCGGAACGGGAGAGGGAGAGCTCTTCTTCCCTCTCAGCGCCGTGCCGCCGCCGTCGAGCCGGGGGTCGGAGGAGGGCGTTTGTCCAGCTCCAGCCCCTATGA
Protein
MRVRALSDEAVSRGGVALAVSLDIANAFNTLPWSVIAGALQYHGVPAYLRRLIGSYLEDRSVVCTGHGGTVLRFPVQRGVPQGSVLGPLLWNIGYDWVLRGTLSTPLPGLSVVCYADDTLVVARGRDLRESARLSCAGVAFVIGRIRRLGLEVALDKSQALLFHEARRAPPQGAHLVIGGVRVEIEATGLRYLGLVLDGRWSFRAHFERLGPRLMAAAGSLSRLLPNVGGPDVVVRRLYTGVVRSMALYGAPVWCHALTRDNVAALRRPQRAIAVRAVRGYRTVSFEAACVLAGTPPWDLEAEALAADYAWRCDLRSRGEARPGAAEVRARKLQSRRAVLEAWSRRLADPAYGRRTVEAIRPVLSDWVNRDRGRLTFRATQVLTGHGCFGRYLHLVARREPTPKCHHCSGCNEDTAEHTLAYCTAFAEQRRVLVAKIGPDLSLPTVVATMLGSDESWQAMLDFCESTILRKEAAERERESSSSLSAPCRRRRAGGRRRAFVQLQPL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    RSAL01000481    RVE41577.1    KZ150386    PZC71062.1    KZ149896    PZC78733.1    D85594    BAA19776.1    LBMM01024063    KMQ82623.1    LBMM01006954    KMQ90166.1    LBMM01019839    KMQ83438.1    LBMM01019838    KMQ83439.1    LBMM01006725    KMQ90373.1    LBMM01006671    KMQ90407.1    LBMM01008682    KMQ88705.1    LBMM01004272    KMQ92618.1    LBMM01006657    KMQ90417.1    LBMM01006063    KMQ90967.1    LBMM01005733    KMQ91252.1    RSAL01003504    RVE40273.1    LBMM01008448    KMQ88867.1    LBMM01015018    KMQ84954.1    LBMM01004634    KMQ92224.1    LBMM01002052    KMQ95336.1    LBMM01007036    KMQ90099.1    LBMM01003245    KMQ93755.1    LBMM01007425    KMQ89740.1    LBMM01004505    KMQ92346.1    LBMM01014956    KMQ84982.1    LBMM01015025    KMQ84953.1    LBMM01005948    KMQ91066.1    LBMM01002480    KMQ94776.1    KMQ94772.1    LBMM01012412    KMQ86235.1    LBMM01005216    KMQ91703.1    LBMM01003988    KMQ92922.1    LBMM01021647    KMQ83033.1    LBMM01005465    KMQ91492.1    LBMM01014122    KMQ85315.1    LBMM01008278    KMQ89009.1    LBMM01008422    KMQ88894.1    ABLF02011238    LBMM01013668    KMQ85535.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01005474    KMQ91485.1    LBMM01004262    KMQ92649.1    GGMR01000779    MBY13398.1    GFXV01002242    MBW14047.1    LBMM01004261    KMQ92650.1    LBMM01006496    KMQ90570.1    LBMM01005845    KMQ91162.1    LBMM01003575    KMQ93366.1    GGMR01015159    MBY27778.1    GGMR01014195    MBY26814.1    LBMM01015285    KMQ84870.1    GFXV01002090    MBW13895.1    GGMR01004600    MBY17219.1    KU543683    AMS38371.1    ABLF02041886    QOIP01000010    RLU18098.1    GALX01004785    JAB63681.1    QOIP01000031    RLU14697.1    ABLF02005203    ABLF02041316    AB090815    BAC57906.1    ABLF02034925    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GFXV01001748    MBW13553.1    LBMM01009527    LBMM01009515    KMQ88059.1    KMQ88067.1    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GFXV01003903    MBW15708.1    GGMR01011682    MBY24301.1    ABLF02013358    ABLF02013361    ABLF02054869    AJ278684    CAB99192.1    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    GGMR01015354    MBY27973.1    GGFJ01001369    MBW50510.1    GGFJ01001727    MBW50868.1    GALA01001777    JAA93075.1    LBMM01004697    KMQ92167.1    GGFK01005660    MBW38981.1    GGMR01012748    MBY25367.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF01553   Acyltransferase
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
Gene 3D
PDB
3J9R     E-value=0.0238315,     Score=89

Ontologies

Topology

Length:
506
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.86718
Exp number, first 60 AAs:
0.832819999999999
Total prob of N-in:
0.04113
outside
1  -  506
 
 

Population Genetic Test Statistics

Pi
35.623891
Theta
16.385046
Tajima's D
3.09165
CLR
18.51489
CSRT
0.984100794960252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号