SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08413
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.678 Nuclear   Reliability : 1.243
 

Sequence

CDS
ATGGAGGAGAGCAGCAGCCGCCCCCGGAAGAAGGGAAGAAAGAAGAAGAAGAAGGAAGTAAGAAGAGGAAGAAGAAGAGGAAGAAAGAAGCGAAGAGAGAAGAAAGAAGTCGTCCCACCAATCACTACGATCCTGCTACATACCATCCCGCAGCGCATCACCCCTGCCTTATTAGGCAGGGAGCTACATGTCCGGGCAGAGGGGTTTCCCCGAGGCCCGCTCCGTGCCCCCCCTAAGGGGGTACGACGACCCCACGACGCCCGCTCCACAGTCGCGGACGCCTACGGGGACCACCCCCGTAGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTATAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCAGGGTGGTTCCGGGACACCTTGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAAGGGGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCATTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCAGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAAACAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCTTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCTCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCCGGATATCGTCTCCGCGCTGTTCCTGCAGGAGCGGGAGGGGTTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGCCCTTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCTGGCCCAGATGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAAGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATATGTTGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCCTTCGAGCCCTCTCGGAGGAGGCCGTCTCCAGGGAAGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAGGAGATTGGGCCTCGACGTGGCGCTCGGTAAATTCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCTCATATCGTGGTTGGAGGCATCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGTACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGCGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCCTACTATAAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTACAAACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACCTGGACACGGCAGAACATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGGTACCGAGTATTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MEESSSRPRKKGRKKKKKEVRRGRRRGRKKRREKKEVVPPITTILLHTIPQRITPALLGRELHVRAEGFPRGPLRAPPKGVRRPHDARSTVADAYGDHPRSASRSFPKWALKRLNKELLMEASIVAAWAPMRPHPVEVEGEAGWFRDTLRRCPGSALDFLIAKGYWWSPEIAQLRVECIRARRECARHRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKKQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPSITERLQPQQLPDIVSALFLQEREGFVAPAMDAPPDYDGEALAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWKTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDMLAEQYGFREGRSTVDAILRLRALSEEAVSREDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALGKFEAMWFHRPRRVPPVDAHIVVGGIRIGVGVQLKYLGLILDSRCTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAAYYKWRADLRARGVARPSPSVVRARRAQSRRSVLESWYKRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSVPSIVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR000477   RT_dom        + More
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF57756   SSF57756        + More
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
829
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.39295
Exp number, first 60 AAs:
0.17619
Total prob of N-in:
0.00924
outside
1  -  829
 
 

Population Genetic Test Statistics

Pi
2.712598
Theta
36.057602
Tajima's D
0
CLR
0.310788
CSRT
0.371581420928954
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号