SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08411
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.721
 

Sequence

CDS
ATGGCGCAAAAAGGTAGAGAAAAACCGTATTCCCTTACGTTAGCATTCTATAATGCTAACGGACTCGCGCGGCAACGCGATCAAATTTTTGAATTCCTCCGCGATAATCTTGTAGATATTCTATTAGTGCAGGAAACCTGTCTGAAGCCCTCGCGTCGCGACCCGAAAGTCGCGAATTACGTCATGGTTAGGAATGACAGACTCACCGCCTCCAAAGGCGGGACTGCCATTTACTATAGGCGGGCCCTGCACGTTGTCCCTCTCGATACTCCCTCGCTCTCACATATCGAGGCGTCAGTGTGCCGTATCTCGCTGACGGGACACCAGCCGATAGTCATCGCATCCGTTTATCTCCCCCCGGACAAGCCCCTTCTGAGCAGTGACATCGAGTCACTGTTCGGCATGGGAGACTCTGTCTCCTTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGTACAAACGTTAACGGTAGGCGTCTCGACGCGTTTATAGACGACCTCACCTTTGAAATAGTCGGTCCCCCAACTCCAACATGTTATCCGTATAACATCGCGCTCCGTCCGAGCACTATAGACCTGGCATTGCTTAGGAACGTAACTCTGCGCTTGCGTTCCATCGAAGCAATGTCAGAGCTCGACTCAGACCACCGACCTGTCGTTATGCAGCTCGGTCGCCCTCACAACCCAGTCACTGTTACGAGGACCATGGTGGATTGGAATAAGCTGGGCACGTGCCTAGCCGACGCCGCTCCGCCAATCCTCCCTTACGGCCCGGATTCGAATCCATCCCCCGAGGACACCGTCGAATCCATAAACATCATTACCAATCACATCTCTTCCGCGATCATTAGATCTTCTAAAGAAGTCGATGTGGAGGACAGCTTCCACCGCATCAGACTGTCCCCCGATCTTAGGAATCTCTTAAGAGTTAGGAACGCGGCAATCCGGGCCTACGATCGTCTTCCCACGCATTCAAACCGGATTCAGATGCGTCGTCTACAACGCGAAGTCCACTCCCGCTTAAGCGACGCGCGTAACGATAATTGGCATAGTTATTTAGAACAACTCGCGCCCTCCCACCAAGCATACTGGCGACTAGCTAGGACTCTCAAATCCGAAACTACCGCTACTATGCCTCCCCTTTTACGCCCTTCAGGCCAACCGCCGGCATTCGATGACGATGACAAGGCTGAGCTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTAGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTGACGAAGTTAGAGACGCGATCCACAACCTCCAACCTAGGAAGGCACCAGGCTCCGACGGCATCCACAACCGCGCGCTAAAATTTTTGCCAGTCCAACTGATAGCAATGTTGGCTACAATTTTAAATGCCGCTATGACGCACTGCATCTTTCCCGCGGTGTGGAAAGAAGCAGACGTTATCGGTATACATAAGCCGGGCAAACCGAGAAACGAAACCTCTAGTTACCGTCCGATTAGTCTCCTCTCGACGATAGGAAAAATTTACGAACGTCTCCTTAGGAAACGCCTCTGGGATTTTGTTACCGCGAACAAAATTCTCATAGACGAACAGTTCGGATTCCGCTCAAAACACTCGTGCGTACAACAAGTGCACCGCCTCACGGAGCACATTCTAATAGGACTAAATAGGCGTAAACAAATCCCGACCGGCGCCCTCTTCTTCGACATCGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTAATCTACAAACTGTACAACATGGGAGTGCCAGACGGACTCGTGCTCATCATACGAGACTTCTTGTCGAACCGTTCGTTTCGATATCGAGTAGAGGGAACTCGTTCTCGTCCCCGTCAACTGACTGCCGGAGTCCCGCAAGGCTCCGCGCTCTCCCCGTTATTATTTAGTTTGTATATCAATGATATACCCCGGTCTCCGGAGACCCATCTAGCGCTCTTCGCCGATGACACGGCTATCTACTACTCGTGTAGGAAGATGTCGCTGCTTCATTGGCGACTCCAGATCGCAGTAGCCACCATGGGACAGTGGTTCCGGAAGTGGCGAATAGACATCAACCCCACGAAAAGCGCAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACATCACTTCGAGCATCCCACTCCGTAGTAGGCGCGCAAACACCTCCGCCGTTAGTCCCATCACTCTCTTTGGCCAGCCCATACCGTGGGTCTCGAAGGTCAAATATCTAGGCGTCACCCTCGACAGAGGGATGACATTCCGCCCCCATATAAAAACGGTACGCGACCGCGCCGCGTTTATTCTAGGACGACTCTATCCAATGCTTTGTAGTCGAAGCAAACTGTCCCTCCGCAATAAGGTAACTCTCTACAAAACTTGTATACGCCCCGTCATGACGTATGCAAGCGTAGTGTTCGCTCACTCAGCCCGCACCCACTTGAAATCCCTTCAGGTTATTCAATCACGATTCTGCAGGATAGCCGTCGGAGCGCCATGGTTCCTTAGGAATATGGATCTCCACGATGACCTGGAGCTCGACTCTCTTAGTAAGTATCTACAGTCGGCATCGCTGCGCCATTTTGAGAAGGCGGCACGACATGAGAACCCTCTCATCGTAGCCGCTGGAAATTACATACCCGACCCAGTAGACCGAATGGTAAACCGTCGACGTCGCCCAAAGCACGTCATTACGGATCCTCCTGATCCATTAACGGTGCTTTTAGGCACCACAAGCACCGGTCACCGTCCTCGTCGAACCCGTCGCTTGCGACGAAGGGCTCGACGAGCGAACTAA
Protein
MAQKGREKPYSLTLAFYNANGLARQRDQIFEFLRDNLVDILLVQETCLKPSRRDPKVANYVMVRNDRLTASKGGTAIYYRRALHVVPLDTPSLSHIEASVCRISLTGHQPIVIASVYLPPDKPLLSSDIESLFGMGDSVSLAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEIVGPPTPTCYPYNIALRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPHNPVTVTRTMVDWNKLGTCLADAAPPILPYGPDSNPSPEDTVESINIITNHISSAIIRSSKEVDVEDSFHRIRLSPDLRNLLRVRNAAIRAYDRLPTHSNRIQMRRLQREVHSRLSDARNDNWHSYLEQLAPSHQAYWRLARTLKSETTATMPPLLRPSGQPPAFDDDDKAELLADALQEQCTTSTQHADPEHTELVDREVERRASLPPSDALPPITTDEVRDAIHNLQPRKAPGSDGIHNRALKFLPVQLIAMLATILNAAMTHCIFPAVWKEADVIGIHKPGKPRNETSSYRPISLLSTIGKIYERLLRKRLWDFVTANKILIDEQFGFRSKHSCVQQVHRLTEHILIGLNRRKQIPTGALFFDIAKAFDKVWHNGLIYKLYNMGVPDGLVLIIRDFLSNRSFRYRVEGTRSRPRQLTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKMSLLHWRLQIAVATMGQWFRKWRIDINPTKSAAVLFKRGRPPNITSSIPLRSRRANTSAVSPITLFGQPIPWVSKVKYLGVTLDRGMTFRPHIKTVRDRAAFILGRLYPMLCSRSKLSLRNKVTLYKTCIRPVMTYASVVFAHSARTHLKSLQVIQSRFCRIAVGAPWFLRNMDLHDDLELDSLSKYLQSASLRHFEKAARHENPLIVAAGNYIPDPVDRMVNRRRRPKHVITDPPDPLTVLLGTTSTGHRPRRTRRLRRRARRAN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ973342    KXZ75569.1    KQ971729    KYB24751.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004395    JAC14317.1    GGMR01018716    MBY31335.1    KQ973412    EFA12510.2    GBBI01004571    JAC14141.1    S59870    AAB26437.2    RPOV01000134    RPJ78669.1    ABLF02042518    ABLF02057746    GGMS01002992    MBY72195.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    NEVH01011985    PNF31054.1    ABLF02008153    ABLF02008462    ABLF02008464    GGFJ01001842    MBW50983.1    GGFJ01001844    MBW50985.1    KK119692    KFM76444.1    GGFJ01001843    MBW50984.1    NEVH01027074    PNF13841.1    NEVH01009134    PNF33528.1    GFTR01008279    JAW08147.1    NEVH01021205    PNF19912.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02023911    GGMS01006359    MBY75562.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    GFTR01008038    JAW08388.1    NEVH01017470    PNF24199.1    NEVH01006736    PNF36716.1    ABLF02034467    M95171    AAA29354.1    ABLF02022418    GGMR01000676    MBY13295.1    GGMR01003407    MBY16026.1    GFTR01008261    JAW08165.1    ABLF02024246    GFTR01008262    JAW08164.1    GFTR01008271    JAW08155.1    GBGD01000415    JAC88474.1    GFTR01008151    JAW08275.1    GFTR01008251    JAW08175.1    ABLF02029306    ABLF02029314    ABLF02060138    GGFJ01002256    MBW51397.1    GFTR01008256    JAW08170.1    GGFJ01002257    MBW51398.1    NEVH01005277    PNF39135.1    GFXV01000908    MBW12713.1    AY180919    AAN87272.1    GFTR01008269    JAW08157.1    NEVH01016302    PNF25823.1    GEZM01084969    JAV60363.1    M22874    M38643    GGMS01017365    MBY86568.1    GGMR01012305    MBY24924.1    NWSH01007753    PCG62823.1    GBGD01000389    JAC88500.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GECL01003538    JAP02586.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    NEVH01026386    PNF14434.1    M38437    GGFL01005122    MBW69300.1    GGFL01005121    MBW69299.1    GGMR01006408    MBY19027.1    NEVH01020940    PNF20481.1    GFTR01008257    JAW08169.1    GFTR01008254    JAW08172.1    ABLF02028535    ABLF02028545    GEDC01000337    JAS36961.1    GEZM01053022    JAV74219.1    GEHC01000968    JAV46677.1    GGMR01004661    MBY17280.1    KK119261    KFM75202.1    JRES01000644    KNC29657.1    GFTR01008260    JAW08166.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMR01016905    MBY29524.1    AF456125    AAL57609.1    AY060438    AAL25477.1    M17214    AAA28508.1    L79944    AAB04627.1    NEVH01022639    PNF18527.1    GGMR01013409    MBY26028.1    ABLF02040174    ABLF02040183    ABLF02055266    KQ973363    EFA13335.2   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF07727   RVT_2
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
5HHL     E-value=0.00927553,     Score=96

Ontologies

Topology

Length:
960
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
1.20325
Exp number, first 60 AAs:
0.00169
Total prob of N-in:
0.00618
outside
1  -  960
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号