SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08410
Annotation
ORF_B_(bases_1850-5560)_first_start_codon_at_2306_[Autographa_californica_nucleopolyhedrovirus]
Location in the cell
Nuclear   Reliability : 3.342
 

Sequence

CDS
ATGGCCGTAGACCCGGACCAAATCTATAAGGCCCTTCGCCCAGTGCCAGAGTTCGACGGCAATCCGAACATACTGACTAGGTTTATCAGAATTTGTGACCAAATCGTCACACAGTATATAAGAACAGATCCTGGCAACGAATTAAATAACCTCAGCCTAATAAACGGTATATTAAATAAAATAACTGGTCCTGCCGCCAGGACCATAAATTCAAATGGCATACCAGAGAACTGGTTAGGTATCCGTACTGCCCTCATTAAAAATTTTTCAGACCAAAGAGATGAGACCGCTTTATACAATGACCTCTCCTTACTAACACAGGGAAACAGTAGCCCCCAGGAGTTTTACGACAAATGCCAGACCCTATTCAGCACTCTCATGACATACGTAACTTTACACGAAAGTATTGCCACAACCATCGAGGCAAAACGCGACTTGTATAAAAAGCTAACAATGCAAGCATTTGTTCGAGGCCTCAAGGAACCCTTGGGATCTCGCATACGCTGCATGAGACCGACCTCCATTGAAAAGGCTCTGGAATTTGTACAGGAAGAACTTAACATAATGTATCTACAACAGCGAAACGGGTTCACCTCTGAACGGCGCAACCTTATTCAGCCTACACCGACACCACCTGTAAAGATACCACCTATGTTTCCGGTAGCAATGCCGAAACCGCTTTCATTCGGACCGAACCCAGGACCGAGCTGGGAACGACAGCCACCACCAGGACCTAATAACCACTGGAAACCTGCTTTCAAATTTAACGCCCCTCAGCGCATGCCTAACATGCCATCACGCACGCAGCAAATGTTCGCATCGCACCCACCAAACTACAACCCCCGTAGCAACGTATTTAGGCTACCTCAGCGGAACCAGGGACCGAAACCTATGAGTGGTATTAGTCACTACGTGGCAAAACAACTTCCACTCACAGGTCATGATTGGAACTTGCTGACTAAATGGAAATCTAGAATCGACCTTAAAGACAACCTACTGATTACAGACAATTCTACCAACCCTATTGAAATGTTCAACTCTCGCAACGTCAACCTGTACGAAGACATCGTACCGGCTAACTCTAGTAAACTAGTTAGAGTACCAATAAATTCATCTGACGGCGAAGTCTATATCCCGCAGCAATATCTGAACAACTGTGTGGTGAACGAATGCATCACGACAGTCGTTAAAAACCGTGTGGTCGGAGACATCAAAAAACGACCCGTTGTCAGTAAGCCATTTGAAACGCACACTCGCATATCCATACAAGTTTCACAATCAAACTTAAGAGAAGACGTCATAAACGCCATTAAAGAATTCGTTAATCCTAAAGTAAAAACTGGCCTCCTTATTAATCCAACATTAAGCATGTACGACATTATACCTATAATACAAGACACGTTCAGAAATTCGGCAATGAATCTCTTACTCACAAAAGTCGAATTAGAAAATGTGAAGGAGTACCTTCGGCAACAAGAAATAATAAGCCACTATCACGATGGAAAAACTAACCACCGCGGAATAAACGAGTGTTATTTAGCTCTTTCGCGAAAATATTACTGGCCGAAAATGAAAGATCAAATTACAAAATTCATAAACGAATGTACTATATGCGGACAAGCTAAATACGATCGCGCACCCATTAAACAGCAGTTTAGCATAGTACCACCCCCGAAGAAACCCTTCGAAATAGTTCATATGGACTTGTTCACCGCCCAATCCGAAAAATACCTGACATTTATTGACGTATTCTCTAAGTACGGACAGGCTTACCTGTTGAGAGACGGCACAGCAATTAGCGTATTACAGGGTCTATTGCAGTTCTGCACGCATCATGGTCTACCTTTAACGATAGTAACTGATAATGGTACAGAATTCACAAACCAATTGTTTTCCGAATTCATACGACTTCACAAAATAAATCATCATAAAACCCTAGCACATACACATAATGACAATGGCAATGTAGAGAGATTCCATTCAACCTTGCTAGAACACCTTCGCATACTTCGCTTACAACATAAAAATGAACCTGTAATAAACTTAATGCCTTATGCAATATTAGCTTACAACAGTTCAGTTCACAGTTTCACCAAATGTCGTCCTTTTGACATCATAACGGGACACTTTGACCCTAGAGACCCTCTCGACATCGACATAACAGCCCATTTACTGCAGCAGTACATGGAATCACATAAAGCTCAAATGACTACAGTTTATGAACTCATAAATGAAACCTCACTTGCTAACCGTACATCTCTCATTGAAAATAGAAATAAGAACCGCGAACCAGAAGCGACGTACCAACCTAACCAACAAGTTTTCATTAAAAACCCGATAGCAGCCCGACAAAAAACAGCCCCGAGGTACACTCAAGATAGAGTGCTAGCAGACTTACCAATTCATATCTACACATCGAAAAAACGAGGCCCTATTGCTAAATCTCGACTTAAACGTGCACATAAGGACTTCCAATTCCTCAAACCCAATCGCGTAAAAAGAGGTCTCATTGATGGCTTAGGTTCAATTGTTAAAAGCATTACAGGAAAGAAAATAGTTATTGTCTTTAAATTTCCTGTAATTTCTCCGGATGAATTCGAACTATATAAATTAACCATTGCCCCTAATAAGCATCAATTAACTTTCATCCCTCCTTATCCTTTCATCGCAACAAATAAGAAAGCGTTCATGTACATAGAGGCTGAATGCCCGAAGTACAACAGGTACTACCTCTGCGAGGAAAATATAAATCACCAGCCAAGAGATGATCCTGATTGCATCCACGATCTTATCTACAATCAAGCCATGAACACTTCATGCCAGCCAACCTCTGTTTCTTTCACTAAAGAAGCCATGGAACAACTAGACGATAAGCATTACGTCCTTATTTTCCCCGAGACCACGAAGATCGAACTTCATTGTCAACGCCTGGAGTACAGTACGCTTCAAGGAAGTTATCTCGTTACCATTCCGCAAAATTGTAAGCTGCGAACCGGACGACTAACACTGGCAAACAATAATGATCAGATCAACGGACAGCCTCTGAAAATAACTGAAATCCCGAAGGATGCAAAAATCACAGGACCCATTAGACCTCATATCAAGCTCACCTCCTTGAACCTGGAGAAAATACACCAAATCCAAGATGATATAATCCAACAACATCCTGTGGACCTAGAACAAAGTGACGTCACGAACAAAGCACTCTTTCATACGACAATACCCTTTTACGGAGCACTCTGCGGCGCGATTGTCCTAGCTGTTGTAATCGCTGTTCATCGGCACAAGTCTTGCAACATAACCCTGGAAAAGAAGCCACGCGAAGAAACCTCAAAATTTCACCCGTACGAGAGTCCAGAAGAACCCCAGAAGAAGGACCGAATTCCGGCAACATTTGCTCTCAAGATTATCAAATAG
Protein
MAVDPDQIYKALRPVPEFDGNPNILTRFIRICDQIVTQYIRTDPGNELNNLSLINGILNKITGPAARTINSNGIPENWLGIRTALIKNFSDQRDETALYNDLSLLTQGNSSPQEFYDKCQTLFSTLMTYVTLHESIATTIEAKRDLYKKLTMQAFVRGLKEPLGSRIRCMRPTSIEKALEFVQEELNIMYLQQRNGFTSERRNLIQPTPTPPVKIPPMFPVAMPKPLSFGPNPGPSWERQPPPGPNNHWKPAFKFNAPQRMPNMPSRTQQMFASHPPNYNPRSNVFRLPQRNQGPKPMSGISHYVAKQLPLTGHDWNLLTKWKSRIDLKDNLLITDNSTNPIEMFNSRNVNLYEDIVPANSSKLVRVPINSSDGEVYIPQQYLNNCVVNECITTVVKNRVVGDIKKRPVVSKPFETHTRISIQVSQSNLREDVINAIKEFVNPKVKTGLLINPTLSMYDIIPIIQDTFRNSAMNLLLTKVELENVKEYLRQQEIISHYHDGKTNHRGINECYLALSRKYYWPKMKDQITKFINECTICGQAKYDRAPIKQQFSIVPPPKKPFEIVHMDLFTAQSEKYLTFIDVFSKYGQAYLLRDGTAISVLQGLLQFCTHHGLPLTIVTDNGTEFTNQLFSEFIRLHKINHHKTLAHTHNDNGNVERFHSTLLEHLRILRLQHKNEPVINLMPYAILAYNSSVHSFTKCRPFDIITGHFDPRDPLDIDITAHLLQQYMESHKAQMTTVYELINETSLANRTSLIENRNKNREPEATYQPNQQVFIKNPIAARQKTAPRYTQDRVLADLPIHIYTSKKRGPIAKSRLKRAHKDFQFLKPNRVKRGLIDGLGSIVKSITGKKIVIVFKFPVISPDEFELYKLTIAPNKHQLTFIPPYPFIATNKKAFMYIEAECPKYNRYYLCEENINHQPRDDPDCIHDLIYNQAMNTSCQPTSVSFTKEAMEQLDDKHYVLIFPETTKIELHCQRLEYSTLQGSYLVTIPQNCKLRTGRLTLANNNDQINGQPLKITEIPKDAKITGPIRPHIKLTSLNLEKIHQIQDDIIQQHPVDLEQSDVTNKALFHTTIPFYGALCGAIVLAVVIAVHRHKSCNITLEKKPREETSKFHPYESPEEPQKKDRIPATFALKIIK

Summary

Uniprot
ProteinModelPortal
PDB
3S3O     E-value=1.28241e-06,     Score=130

Ontologies

Topology

Length:
1138
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.15532
Exp number, first 60 AAs:
0.00073
Total prob of N-in:
0.00063
outside
1  -  1069
TMhelix
1070  -  1092
inside
1093  -  1138
 
 

Population Genetic Test Statistics

Pi
308.472273
Theta
196.481744
Tajima's D
2.816002
CLR
46.119972
CSRT
0.967151642417879
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号