SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08401
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
PlasmaMembrane   Reliability : 1.909
 

Sequence

CDS
ATGCGTGTCTATATCCCGTCCGGGTTTAGTTGGGATAGCCTCTTAGACTACAAGCGACTAGGTAGAGAGAAACAAAAGAGTCTATACTATGTATCCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCAGCCCGCATCATCCAGCATCTGGCCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACCGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGCGGGGTGGCCCTGGCGGTATCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGATGGGATCGTGCACCGATTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTCTGTGGAATATCGGGTATGACTGGGTGCTAAGAGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGCTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGTTGGGGCCCCGGAGAGTGCCACCTATCGATGCTCAAATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGGTCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCATTGGGATAGCCTCTTAGACTACAAGCGACTAGGTAGAGAGAAACAAAAGAGTCTATACTATGTATCCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGTATTCTGGCAGCCCGCATCATCCAGCATCTGGCCGGGGTGGGACCCGATCTGTCGGCGGAACAGTATGGCTTCCGAGAGGGCCGCTCAACCGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGCGGGGTGGCCCTGGCGGTATCACTCGATATCGCCAATGCGTTCAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAAAGACACGGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGATGGGATCGTGCACCGATTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCTCTTCTGTGGAATATCGGGTATGACTGGGTGCTAAGAGGTGCCCTCCTCCCGGGCCTGAGTGTAATCTGCTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGTTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCACTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTATCGATGCTCAAATCGTGGTTGGAGGCGTCCGTATTGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGGTCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCAAAGTTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGCGGCTATCGCACCATCTCCTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATCAGTGGCGGGCTGACTTTCGTGCCCGGGGCGTGGCGCGCCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAATCATGGTCCAGGCGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCAGTCCTTGTGGACTGGGCGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCAGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAGAATAGGAAACGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCGCAAGCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATATCGCCCAAGCCCTGGCCCTCTAA
Protein
MRVYIPSGFSWDSLLDYKRLGREKQKSLYYVSVLLDEVGKLLERILAARIIQHLAGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHDGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLPLGPRRVPPIDAQIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYHWDSLLDYKRLGREKQKSLYYVSVLLDEVGKLLERILAARIIQHLAGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHGVPPYLRRLVGSYLEDRSVTCTGHDGIVHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATVGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPIDAQIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADFRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWANRDRGRLTFRLTQVLTGHGCFGEFLHRIRAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVARIGNDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQARRRRAGAREADIAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=1.7776e-05,     Score=119

Ontologies

GO

Topology

Length:
919
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.35723
Exp number, first 60 AAs:
0.00396
Total prob of N-in:
0.00389
outside
1  -  919
 
 

Population Genetic Test Statistics

Pi
28.463056
Theta
23.957885
Tajima's D
0.577024
CLR
1291.188062
CSRT
0.539973001349933
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号