SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08380
Pre Gene Modal
BGIBMGA009215
Annotation
PREDICTED:_uncharacterized_protein_LOC105842527_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.192
 

Sequence

CDS
ATGCAACAGCTTGGACATTCTCAAACACAAGCCGCAGGTGCGCTGGTGCAGCGGGCCATTGGCAACAGAGAGGCAAAATTGGTGCATACTGGCTTACCATCTCGACCCTGCCATCAAGGAAACGGAATACTCGATATCGCACTGGTGACACAAGAGGCCATGGAGTACACTTATCGAACGAAGCAACTCGATTCTATCTCGTCAGATCACTATCCGTGGCAATTGGAAGTTGATATAGAGGCGCACGAACATGTGCTACTGAGGCGAAAGATGAGCAGCATTACTGAAACTAAGGAGTCTCGCATCAAATTCCAAGAGTTAATCGAAGCAAATCTTCCAGTAATTGTGCCAACCACTGATGCGGAAGCAGATTCATACGTCGATAACTTGGAAAATGTACTCACTGCGGCATTAGATGAGATGGCGCCGCTACGAGAGTCAACACGACGGGAGGAATTGCCAATAAACATCCAATACCTGATACAACATCGCAACCGAAGCAAACTAAAGCAAAAAATGCACCAAGAGGACATATTCTCCGTCGGATATACAACGCTGCAAATTTAA
Protein
MQQLGHSQTQAAGALVQRAIGNREAKLVHTGLPSRPCHQGNGILDIALVTQEAMEYTYRTKQLDSISSDHYPWQLEVDIEAHEHVLLRRKMSSITETKESRIKFQELIEANLPVIVPTTDAEADSYVDNLENVLTAALDEMAPLRESTRREELPINIQYLIQHRNRSKLKQKMHQEDIFSVGYTTLQI

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
188
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.15579
outside
1  -  188
 
 

Population Genetic Test Statistics

Pi
203.026903
Theta
142.727353
Tajima's D
1.270014
CLR
0
CSRT
0.731113444327784
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号