SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08374
Annotation
PREDICTED:_uncharacterized_protein_LOC101738890_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.714
 

Sequence

CDS
ATGCACGGAAAAATCGATTACACCAAACATCAATTAATATTAAATAAAATTCCATTTAAGCTACAATTTAACGAGCCTATATGCGTAATTCCTCCAAGATCCGAAACCATAATTGAATGCACCGTATTAAACCCTGAAATCCATGAAGGCCTCATTTTAGATCAACGTCCAATTGAAAACCTACTCATTGCCAACTGCATCGTCAAAATCAAAGAAAATTCAAGAGTCAACATATCCGTTGTAAATACATCCGAACAACCCCTATCTTTTAGCTCCGATCTAAAACTAAAATTGACACCACTCGATAACATAGAACAAATACAAAAAATATACAATATTGATTCGGATAACCCACATAATTCTAACAACCCTAATGATCACAATGCATACCTTAGAACAAAAAGGGTTCTTGAACAAATTCGTATCGCCCATCTAAACTACGAAGAAAAATCACAGCTTTTCGAAGTATGCGAACAATTCTCAGATATTTTCCATCTCCCTGGCGATCTATTGACATATACAAATGAAATAAAACATGAAATAAAAACGACAACATCAACTCCCATCCACGTTAAAACGTATCGTTTCCCAGAGTGCCACAAGAAGGAAGTCAACACACAAATCCACAAAATGTTAGAACAAGGTATCATTAAACCTTCAGCATCCCCCTGGTCGTCTCCAATCTGGGTCGTACCTAAAAAAGCTGACGCTTCTGGTGAAAAGAAGTGGAGGGTAGTCATAGACTACCGAAAACTTAATGATATCACCATCGGAGACTCATACCCCATTCCAAACATATCTGAAATATTAGACCAACTTGGTAAGAGTAAATACTTTAGCACGTTAGACCTTGCTTCCGGATTTCATCAAATTCAAATGAACCCTGAGGATTCTGCGAAGACAGCTTTTACTGTTCCCCAAGGTCAATTCGAATTCAGTCGTATGCCTTTTGGTCTTAAAAATGCACCATCTACATTTCAAAGACTAATGAATTCGGCACTTTCGGGTCTGCAAGGAATGCAATGTTTCGTCTATCTGGATGACATTGTTATCTATTCTGTTGATCTCGATGATCACATCTACAACCTATCAAATGTTTTCAAACGACTCCGCCAGTATAACCTTAAACTACAACCCGATAAATGCGAGTTTTTACGAAAAGAAGTATCTTATCTAGGACATATTATAACTGACCAAGGTGTTAAACCAAACCCCGATAAAATTGAAGCGGTAGAACGTTTCCCCACTCCGAAGACTCCAAAAGACATCAAATCTTTCTTGGGATTCGTTTCTTATTATCGTAGATTCATTTCAGACTTCTCTAAGTTAGCAAAACCCTTGACAAACCTTCTAAAAAAGGACACTCCCTTCTTATGGGAAAATGAACAACAACTCGCATTCGACGCCCTAAAACAAAAATTGATCTCAGCCCCTCTGTTAGCATACCCCGATTTCTCAAAGACATTCATTTTAACTACAGACGCATCTAATTACGCCATCGGCGCTATTCTGTCACAGGGCGAACTAGGCAAGGATAGACCTATAGCCTACGCTTCGAGAACCCTGAATAAAAGCGAGTGTAACTATAATACTACAGAAAAGGAATTACTCGCCATCTTATTCGGTTGCAAAACGTTTCGACCATACCTGTACGGCAGACACTTTCAAATAGTAACCGATCATCGACCCTTAAAATGGCTTTTTAATCACAAAGACCCGAGTAGTAAGTTACAAAGATGGAGACTGAAACTCGAGGAATATGAGTATGAAATAATATATAGGAAAGGAAAATTTAATGCTGCAGATGCTCTTTCACGTTACCCGACTGAAAAAGCGGTACTAGTAAACCCTATAAATCCTGAACCTACTCCAGGACCCTCAGTGACCGACGACAACAGTCCCTTGTTTCCAGAGTCTAGAAATTCACCTGACTGCGATCACCTCCTAAACCCAGATGCCATACCCTCTCTAATCGGAAATCCAGGAGACCCACTTGATTTACCAGATGACCTCAGAGATCTGAACCTCGAAGGACTCGATGCTCCAGATCAACCTAATGAAAATCCAACTCCTAATCTTCCTCCGACACCTGACCCTAACCCTCCTAATATTTCGAATGACATAATCGATCCTCTGAATAGTCCCAACTTGAGGTCAGAAACATATTCAGAATTCCTTAAAATCATAACTGATAGGAATTACCACCCTAACACCAAAATTATAGAACACAATGGAAATTTACTAGACTCGCCGCACAAACATATAATTATTCCTACATCCATAGACTTCGACGAATCAATACCTTATACAGAAAACATTATCGATAGCTTTGAAGACAAAGAACAATTTCTAAGAAAAGAAAGAACATTAAACTCATTTTTAACACACCCTAAACAACAAAAAACTTACTATTTCTTGTTTACGAAAGTTTATCATTTTGACCAATCTTCATACACAGACATATTCGAGAGCTTGAAAGCGCTCAGAAATGAACTTATCCTCTTATTGAGCGAAAGTGATAATGCTATCTCTATTTCCGATTTTAAGACCCCCTTTGACAAACATCATTTCATTAAAATTTACAACATGATTCTTTATCTCTTTAACAACACTAACATCGAAATACACATTTATCATAATAATATACGATATCCGACTCTACGCGAAATAAAACAAATTTTGAAAGATAATCACGACTTACCCATTGCTGGTCATCTAGGCGGTACTAGAATGCTTAAGAGGATTCAGGAAAAATATTATTGGAAGGGCATGCGTAGTGACGTCGAAAATTACGTCAAATCGTGTAAATTGTGCCAAGAAAACAAGGCGCTGCGCAAAATCTCACGTGCACCGATGCGAATCACAACTACGTCATCAACTCCATTTCAAAGACTAGCTCTGGACATAGTTGGTCCCTTACCAGATTCCGGCCCTGCGAGACTTAAATATATTCTAACCTTACAAGATGACCTCACTAAGTATTCTATAGCTTATCCGACCCGTTCCACTACAGCAGAGGAAACTTGTGAGTGCCTCTTACATTTTATTTCACTCTTTGGCATACCAAAGGCAATTTTAACAGACCAAGGGACTAATTTCACATCAGAACTCTTTAAGAAAACCTGCAACTTTTTAAAAATCAAACAGCTTTGGTCGAGTCCATATCACCCACAAACTCAGGGCGCGTTAGAACGCAGCCATTCAACTTTAAAGGAGTACCTGAAATCATTTGTTAATGAAGATCAAGATAACTGGCATCGCTACGTCTACACCGCCATGCTATCTTATAACACTAGTGTTCATAGTACGACAAACTACACCCCTTACGAATTGTTATTCGGTCACAAACCTTACTTACCTGATTCCATCTATGAATCTACTCCCGATCCAACATACCCAGAGTATCTCAAAATGCTAACTCACAGACTAAAATTTTCAAGAGAGAAAGCGATTAAAAACATACAGACTTCTAAAGAAAGATCGAAAGTATATTATGATAATCACTCACGACCTATGAAATACAAAGTAGGAGATCTAGTCTATCTCAGGAACCACTTACGCCTTAGGAAAGCACTCTCACCAACATGGAAAGGCCCGTATAAAATTCTACAAATACATAATAATAATACTGTAACCTTACTCATCAACAGAAGACATGTTACACACCATTTCGATCAAATTAAACCTGCAATATCATCTAACTGA
Protein
MHGKIDYTKHQLILNKIPFKLQFNEPICVIPPRSETIIECTVLNPEIHEGLILDQRPIENLLIANCIVKIKENSRVNISVVNTSEQPLSFSSDLKLKLTPLDNIEQIQKIYNIDSDNPHNSNNPNDHNAYLRTKRVLEQIRIAHLNYEEKSQLFEVCEQFSDIFHLPGDLLTYTNEIKHEIKTTTSTPIHVKTYRFPECHKKEVNTQIHKMLEQGIIKPSASPWSSPIWVVPKKADASGEKKWRVVIDYRKLNDITIGDSYPIPNISEILDQLGKSKYFSTLDLASGFHQIQMNPEDSAKTAFTVPQGQFEFSRMPFGLKNAPSTFQRLMNSALSGLQGMQCFVYLDDIVIYSVDLDDHIYNLSNVFKRLRQYNLKLQPDKCEFLRKEVSYLGHIITDQGVKPNPDKIEAVERFPTPKTPKDIKSFLGFVSYYRRFISDFSKLAKPLTNLLKKDTPFLWENEQQLAFDALKQKLISAPLLAYPDFSKTFILTTDASNYAIGAILSQGELGKDRPIAYASRTLNKSECNYNTTEKELLAILFGCKTFRPYLYGRHFQIVTDHRPLKWLFNHKDPSSKLQRWRLKLEEYEYEIIYRKGKFNAADALSRYPTEKAVLVNPINPEPTPGPSVTDDNSPLFPESRNSPDCDHLLNPDAIPSLIGNPGDPLDLPDDLRDLNLEGLDAPDQPNENPTPNLPPTPDPNPPNISNDIIDPLNSPNLRSETYSEFLKIITDRNYHPNTKIIEHNGNLLDSPHKHIIIPTSIDFDESIPYTENIIDSFEDKEQFLRKERTLNSFLTHPKQQKTYYFLFTKVYHFDQSSYTDIFESLKALRNELILLLSESDNAISISDFKTPFDKHHFIKIYNMILYLFNNTNIEIHIYHNNIRYPTLREIKQILKDNHDLPIAGHLGGTRMLKRIQEKYYWKGMRSDVENYVKSCKLCQENKALRKISRAPMRITTTSSTPFQRLALDIVGPLPDSGPARLKYILTLQDDLTKYSIAYPTRSTTAEETCECLLHFISLFGIPKAILTDQGTNFTSELFKKTCNFLKIKQLWSSPYHPQTQGALERSHSTLKEYLKSFVNEDQDNWHRYVYTAMLSYNTSVHSTTNYTPYELLFGHKPYLPDSIYESTPDPTYPEYLKMLTHRLKFSREKAIKNIQTSKERSKVYYDNHSRPMKYKVGDLVYLRNHLRLRKALSPTWKGPYKILQIHNNNTVTLLINRRHVTHHFDQIKPAISSN

Summary

Uniprot
ProteinModelPortal
PDB
4OL8     E-value=3.06281e-76,     Score=730

Ontologies

Topology

Length:
1234
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00326
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00007
outside
1  -  1234
 
 

Population Genetic Test Statistics

Pi
37.615433
Theta
52.067133
Tajima's D
-1.361748
CLR
0.332641
CSRT
0.0784960751962402
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号