SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08359
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.967
 

Sequence

CDS
ATGGGGGACGCGGTCATCCTGGCAGGCGATTTAAATTGCCACCACACTAGGTGGAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAGTATTCAACCCCCCGACCCCCACGTGCTATCCGTACAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGTACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAACCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGAACTTAGGGACCTCGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTCAAACCGGACTCGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAACCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAGCAGTGCACCACCAGCACTCAACACGCGGACCCCGAACACACCGAGTTCGTCGACAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTCAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAACTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTGGCACAACGGTTTGATATACAAACTGTATAACATGGGAATGCCAGACAGACTCGTGCTCATCATACGAGACTACTTGTCGAACCGTTCGTTCCGATATAGAGTCGAGGGAACGCGTTCCCGGCCCCGTCACGTCACAGCCGGAGTCCCGCAAGGCTCCGCTCTCTCCCCGTTACTATTCAGTTTGTATATCAACGATATACCCCGGTCTCCGGAGACCCATCTGGCGCTCTTCGCCGATGACACCGCCATCTACTACTCGTGTAGGAAGAAGGCGTTGCTTCATCGACGACTTCAGACCGCGGCTACCACCATGGGACAGTGGTTCCGGAAGTGGCGCATCGACATCAACCCCACGAAAAGCACAGCGGTGCTCTTCAAAAGGGGTCGCCCTCCGAACACCACGCTGAGCATCCCCCTCCCGACTATGCGCGTCAATAACCCCGCCCCCGCCGTTCGCCCAATCACGATGTTCGACCAGCCCATACCGTGGGCCCCGAAGGTCAAATATTTAGGCGTCACCCTCGACAGTAGGATGACATTCCGCCCCCACATCAAGACGGTACGCGACCGTGCCGCCTTCATTCTAGGACGTCTCTACCCGATGATATGTAGGCGAAGTAAAATGTCCCTTAGAAATAAGGTGACACTCTACAAAACTTGCATACGCCCCGTCATGACCTATGCAAGTGTAGTGTTCGCTCACGCGGCCCGCATACACTTAAAATCCTTTCAAATTATTCAATCCCGTTTTTGCAGGATAGCCGTCGGAGCCCCGTGGTTCGTCAGGAACGTCGACCTCCATGACGACCTGGACTTAGAGTCCATCAGTAAGTATCTGCAGTCGGCGTCCATGCGCCACTTCGATAAAGCGGCACGACACGAGAACCCTCTCATCGTGGCCGCCGGTAACTACATTCCCGATCCTGCGGACAGAATGGAAAGCAGTCGACGTCGCCCTAAACACGTCATCTCGGATCCTCCTGATCCACTAACGGTGCTTTTAGAAATATAA
Protein
MGDAVILAGDLNCHHTRWNCHRTNVNGRRLDAFIDDLTFEVFNPPTPTCYPYNAARRPSTIDLVLLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPELRDLVRIRNAAIRAYDRYPTDSNRTRMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQPPAYDDDDKAELLADALQEQCTTSTQHADPEHTEFVDREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKVWHNGLIYKLYNMGMPDRLVLIIRDYLSNRSFRYRVEGTRSRPRHVTAGVPQGSALSPLLFSLYINDIPRSPETHLALFADDTAIYYSCRKKALLHRRLQTAATTMGQWFRKWRIDINPTKSTAVLFKRGRPPNTTLSIPLPTMRVNNPAPAVRPITMFDQPIPWAPKVKYLGVTLDSRMTFRPHIKTVRDRAAFILGRLYPMICRRSKMSLRNKVTLYKTCIRPVMTYASVVFAHAARIHLKSFQIIQSRFCRIAVGAPWFVRNVDLHDDLDLESISKYLQSASMRHFDKAARHENPLIVAAGNYIPDPADRMESSRRRPKHVISDPPDPLTVLLEI

Summary

EMBL
AB018558    BAA76304.1    U07847    AAA17752.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005299    JAB63167.1    GALX01005359    JAB63107.1    GBBI01004571    JAC14141.1    GGMS01006359    MBY75562.1    GBBI01004395    JAC14317.1    S59870    AAB26437.2    ABLF02042518    ABLF02057746    GFTR01008038    JAW08388.1    RPOV01000134    RPJ78669.1    ABLF02029306    ABLF02029314    ABLF02060138    GGMR01018716    MBY31335.1    GGMR01019198    MBY31817.1    GGMR01003407    MBY16026.1    GGMS01002992    MBY72195.1    NEVH01006736    PNF36716.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GGFJ01001842    MBW50983.1    GGFJ01001843    MBW50984.1    GGFJ01001844    MBW50985.1    GFTR01008262    JAW08164.1    GEZM01053022    JAV74219.1    GGFL01005012    MBW69190.1    GGFL01004957    MBW69135.1    GFTR01008271    JAW08155.1    GGMR01012305    MBY24924.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    NEVH01026386    PNF14434.1    ABLF02024246    GFTR01008279    JAW08147.1    GGMR01000676    MBY13295.1    GEDC01000337    JAS36961.1    GGMS01017365    MBY86568.1    GGFJ01001858    MBW50999.1    GGMS01000737    MBY69940.1    NEVH01020940    PNF20481.1    KQ973363    EFA13335.2    KK119692    KFM76444.1    GGFJ01001857    MBW50998.1    ABLF02034467    GGMR01006408    MBY19027.1    ABLF02008153    ABLF02008462    ABLF02008464    GEZM01084969    JAV60363.1    GFXV01000908    MBW12713.1    JRES01000644    KNC29657.1    GBHO01010547    GBHO01010546    JAG33057.1    JAG33058.1    GGFJ01001822    MBW50963.1    GBHO01021814    GBHO01010549    JAG21790.1    JAG33055.1    AF456125    AAL57609.1    GFTR01008261    JAW08165.1    AY180919    AAN87272.1    GFXV01007093    MBW18898.1    NEVH01016302    PNF25823.1    NWSH01000032    PCG80496.1    ABLF02040174    ABLF02040183    ABLF02055266    GFTR01008251    JAW08175.1    GGMS01002955    MBY72158.1    GGMR01016296    MBY28915.1    LBMM01013518    KMQ85605.1    ABLF02033757    GFTR01008256    JAW08170.1    ABLF02028535    ABLF02028545    NEVH01006721    PNF37225.1    GBBI01003810    JAC14902.1    GGMR01013409    MBY26028.1    GFTR01008269    JAW08157.1    NEVH01011985    PNF31054.1    GBGD01000415    JAC88474.1    GBGD01000389    JAC88500.1    ABLF02014118    ABLF02014121    ABLF02054790    NEVH01027074    PNF13841.1    GGMR01014053    MBY26672.1    NEVH01009134    PNF33528.1    GGMR01003864    MBY16483.1    NEVH01005295    PNF38784.1    GFTR01008257    JAW08169.1    NEVH01022639    PNF18527.1    GGMR01000226    MBY12845.1    NWSH01007753    PCG62823.1    DNOY01000259    HBE18313.1    GBBI01001646    JAC17066.1    KQ973412    EFA12510.2    GGMR01016905    MBY29524.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
6AR3     E-value=0.00125321,     Score=102

Ontologies

Topology

Length:
807
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.39248
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00146
outside
1  -  807
 
 

Population Genetic Test Statistics

Pi
31.390554
Theta
44.156388
Tajima's D
0.834395
CLR
0.326955
CSRT
0.615269236538173
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号