SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08349
Pre Gene Modal
BGIBMGA009273
Annotation
PREDICTED:_transient-receptor-potential-like_protein_[Amyelois_transitella]
Full name
Transient-receptor-potential-like protein      
Location in the cell
Cytoplasmic   Reliability : 2.652
 

Sequence

CDS
ATGGCCGAGAAGAAGGATTTGGAAGCCGGCGACCCTGAATTGGAATGCGTCCGGAAACCAATGCCGTTACCGGTGCTCCCAAAACCACTTACTTTGGAAGAAAAGAAGTATTTGCTGGCAGTCGAGAGAGGAGATATGGCAAATGTGAGAAGATTACTCCAAAAAGGCCACCGCAAAAAACACATCGACATCAATTGCGTAGACTCTCTCGGTCGCGGGGCTTTGACCTTGTCAATTGACGGGGAGAACTTAGAGATGGTGGAACTCCTCGTCATCATGGGAGTGGAAACAAGAGACGCTTTGCTGCAAGCAATCAACGCGGAGTTTGTTGAAGCAGTTGAATTGTTACTAGAGCATGAAGAGTTAATTCACAAAGACGGTGAACCATACAGCTGGCAAAAAGTTGATCCAAACACAGCAATGTTCACTCCGGACATAACACCTCTGATGCTGGCGGCTCATAAGAACAACTATGAAATAATCAAGATACTTCTAGATCGTGGTGCCACTTTACCTAACCCTCATGACGTCAGATGTGGCTGCGAGGACTGTATCCGACAATCTACTGAGGACTCTCTGCGACACTCACTGGCACGCCTCAATGAATATCGAGCTTTGGCATCTCCGTCGCTCATAGCTCTGTCTTCTACAGATCCTATATTAACAGCCTTCGAATTGTCTTGGGAACTGAGGAATTTAGCCTTTGCTGAACAGGAAAGTAAAGCGGAATACCTGGAACTACGGAGACAGGCGCAACTGTTTGCTGTAGATCTGCTCGATCAATCCCGAAGCTCCCAAGAGCTGGCCATCATTCTCAATCATGATCCTGACGAACCAGCCTTTGTTGACGGAGAACACATGAAATTAGCACGTTTGGAATTGGCCATTGATTTTAAGCAGAAAAAGTTCGTAGCTCACCCTAACATCCAACAATTGCTGGCCTCTATCTGGTACGAAGGTGTCCCTGGATTCCGTCGTAAAACTACAATGGAGAAGATCATGATCATCTGTCGCGTCGCCCTATTGTTCCCTTTCTACTGCACTCTGTACATGATAGCCCCAAACTGCGCCACCGGAAAACTAATGAGGAAACCTTTCATGAAGTTCTTAATTCACGCTTCTAGTTACTTATTCTTTTTGTGTAAGTAA
Protein
MAEKKDLEAGDPELECVRKPMPLPVLPKPLTLEEKKYLLAVERGDMANVRRLLQKGHRKKHIDINCVDSLGRGALTLSIDGENLEMVELLVIMGVETRDALLQAINAEFVEAVELLLEHEELIHKDGEPYSWQKVDPNTAMFTPDITPLMLAAHKNNYEIIKILLDRGATLPNPHDVRCGCEDCIRQSTEDSLRHSLARLNEYRALASPSLIALSSTDPILTAFELSWELRNLAFAEQESKAEYLELRRQAQLFAVDLLDQSRSSQELAIILNHDPDEPAFVDGEHMKLARLELAIDFKQKKFVAHPNIQQLLASIWYEGVPGFRRKTTMEKIMIICRVALLFPFYCTLYMIAPNCATGKLMRKPFMKFLIHASSYLFFLCK

Summary

Description
A light-sensitive calcium channel that is required for inositide-mediated Ca(2+) entry in the retina during phospholipase C (PLC)-mediated phototransduction. Required for vision in the dark and in dim light. Binds calmodulin. Trp and trpl act together in the light response, although it is unclear whether as heteromultimers or distinct units. Also forms a functional cation channel with Trpgamma. Activated by fatty acids, metabolic stress, inositols and GTP-binding proteins.
Subunit
Forms heteromultimers with Trpgamma and, to a lower extent, with trp. Interacts with FKBP59 in vivo and is found in the inaD signaling complex.
Similarity
Belongs to the transient receptor (TC 1.A.4) family.
Belongs to the transient receptor (TC 1.A.4) family. STrpC subfamily.
Keywords
ANK repeat   Calcium   Calcium channel   Calcium transport   Calmodulin-binding   Complete proteome   Ion channel   Ion transport   Membrane   Reference proteome   Repeat   Sensory transduction   Transmembrane   Transmembrane helix   Transport   Vision  
Feature
chain  Transient-receptor-potential-like protein
EMBL
BABH01022308    ODYU01003065    SOQ41367.1    RSAL01000028    RVE51848.1    NWSH01004108    + More
PCG65488.1    KQ459585    KPI98238.1    KQ459786    KPJ19920.1    AGBW02013881    OWR42592.1    CH477348    EAT42934.1    GFDL01004651    JAV30394.1    DS231910    EDS45746.1    GGFJ01001365    MBW50506.1    GGFJ01001367    MBW50508.1    AAAB01008796    EAA03611.5    KC292630    AGG86915.1    KQ971338    EFA02859.1    ATLV01024272    KE525351    KFB51162.1    ADMH02002175    ETN58052.1    AXCM01007166    APCN01006537    AXCN02001829    GAMD01002929    JAA98661.1    GGFK01003627    MBW36948.1    GGFK01003642    MBW36963.1    GGFK01003597    MBW36918.1    GGFK01003628    MBW36949.1    ACPB03011940    ACPB03011941    UFQS01001431    UFQT01001431    SSX10849.1    SSX30529.1    JXUM01136915    JXUM01136916    JXUM01136917    KQ568500    KXJ68981.1    JXUM01030796    KQ560896    KXJ80443.1    KX249689    AOR81466.1    GBRD01011882    JAG53942.1    GEBQ01010897    JAT29080.1    CVRI01000063    CRL04302.1    GBHO01030377    JAG13227.1    GEDC01000871    JAS36427.1    JRES01000890    KNC27516.1    EZ422050    ADD18473.1    GBXI01010130    GBXI01008708    GBXI01004578    JAD04162.1    JAD05584.1    JAD09714.1    GDHF01005173    GDHF01001552    GDHF01000136    JAI47141.1    JAI50762.1    JAI52178.1    KK852485    KDR22808.1    KA646945    AFP61574.1    GAKP01010448    GAKP01010447    JAC48505.1    GAMC01021170    JAB85385.1    GAMC01021171    JAB85384.1    GDHC01010100    JAQ08529.1    CH902619    EDV37313.1    KPU76709.1    KPU76710.1    M88185    AE013599    BT001397    BT099607    CH480816    EDW47147.1    JXJN01014362    JXJN01014363    CH954177    EDV58216.1    CM000157    EDW89546.1    KRJ98521.1    KRJ98522.1    CH479183    EDW35552.1    CM000071    KRT02893.1    EAL26165.2    KRT02894.1    KRT02892.1    KRT02895.1    CH963850    EDW74963.1    OUUW01000001    SPP74037.1    CM002911    KMY92564.1    KMY92565.1    KMY92566.1    KMY92562.1    CH916375    EDV98121.1    CH940648    EDW60491.1    KRF79437.1    KRF79438.1    KRF79439.1    KRF79440.1    KB632375    ERL93959.1    CH933808    KRG05424.1    EDW10668.1    CCAG010006888    MG020535    AUC64091.1    APGK01013995    APGK01013996    APGK01013997    APGK01013998    APGK01013999    APGK01014000    KB739168    ENN82359.1    KMY92563.1    ADMH02001356    ETN62865.1    KRT02896.1    GDIP01119518    JAL84196.1    ABLF02021769    ABLF02021770    ABLF02021771    ABLF02052683    JXUM01004958    JXUM01004959    JXUM01004960    JXUM01004961    JXUM01004962    KQ560184    KXJ83949.1    GDIP01094025    JAM09690.1    AXCM01012156    GDIQ01144554    JAL07172.1   
Pfam
PF00023   Ank        + More
PF08344   TRP_2
PF00520   Ion_trans
PF12796   Ank_2
PF13606   Ank_3
Interpro
IPR002110   Ankyrin_rpt        + More
IPR013555   TRP_dom       
IPR002153   TRPC_channel       
IPR005821   Ion_trans_dom       
IPR020683   Ankyrin_rpt-contain_dom       
IPR036770   Ankyrin_rpt-contain_sf       
IPR000435   Tektin       
SUPFAM
SSF48403   SSF48403       
Gene 3D
PDB
6G1K     E-value=3.85762e-81,     Score=767

Ontologies

Topology

Subcellular location
Membrane  
Length:
382
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
21.32642
Exp number, first 60 AAs:
0
Total prob of N-in:
0.68118
inside
1  -  334
TMhelix
335  -  357
outside
358  -  382
 
 

Population Genetic Test Statistics

Pi
17.466273
Theta
160.515432
Tajima's D
0.201529
CLR
0.647108
CSRT
0.431878406079696
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号