SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08347
Pre Gene Modal
BGIBMGA009272
Annotation
PREDICTED:_transient_receptor_potential_protein_isoform_X1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.957
 

Sequence

CDS
ATGTGGTATTATGCTGAACTAGAAAAAGACAAATGTTACCACCTTCCAAATGGGTTGCCAGATTTCGATGGGCAAGAAAGAGCCTGTTCAATTTGGAGAAGATATGCTAATTTGTTCGAGACCTCTCAGTCGCTGTTCTGGGCTTCTTTTGGGCTCGTCGATTTGACGACGTTCGAGTTGACCGGTATCAAAAGTTTTACAAGATTTTGGGCTCTTCTGACTTTTGGATCGTATTCCGTTATTAACATAATAGTCCTGCTCAACATGCTGATTGCCATGATGTCGAACTCATATCAAATAATTTCCGAACGAGCGGATACTGAATGGAAATTCGCCCGCAGTAATCTTTGGATGTCTTACTTCGAAGATGGCGACACCGTCCCGCCGCCGTTCAACATCATACCGACGCCAAAGCATTTCTTTTGCTGGATCAAAAGCTATTTTAACAAACGAGAAAGGCGTTCAATACTCAACAAATCTCGTGAAAAAGCTAGACAGGAACACGAAGCGGTAATGAGGATATTAGTCAGAAGATACGTGACAGCAGAACAAAGGGCTAGAGATGAAGTAGGAGTCACGGAGGATGACGTTATGGAGATCCGTCAAGATATATCCACACTCAGATACGAGCTCATTGATATACTGCATAACAATGGAATGAAGACACCAAGAGTCAGCTTGCAGGATACTGCCGGTAATAATTATAATCTTAAAATTTCGAATTATCTACACTACCCGATGATTGTTTAA
Protein
MWYYAELEKDKCYHLPNGLPDFDGQERACSIWRRYANLFETSQSLFWASFGLVDLTTFELTGIKSFTRFWALLTFGSYSVINIIVLLNMLIAMMSNSYQIISERADTEWKFARSNLWMSYFEDGDTVPPPFNIIPTPKHFFCWIKSYFNKRERRSILNKSREKARQEHEAVMRILVRRYVTAEQRARDEVGVTEDDVMEIRQDISTLRYELIDILHNNGMKTPRVSLQDTAGNNYNLKISNYLHYPMIV

Summary

Similarity
Belongs to the transient receptor (TC 1.A.4) family.
EMBL
BABH01022307    BABH01022308    ODYU01002911    SOQ40997.1    ODYU01005013    SOQ45484.1    + More
NWSH01004304    PCG65240.1    PCG65239.1    KZ150121    PZC73176.1    RSAL01000028    RVE51850.1    KQ459585    KPI98235.1    AGBW02013881    OWR42590.1    GEDC01000920    JAS36378.1    GEDC01017419    JAS19879.1    GBYB01002831    JAG72598.1    GBYB01002829    JAG72596.1    KB632375    ERL93960.1    LBMM01006483    KMQ90580.1    APGK01007747    APGK01007748    APGK01007749    APGK01007750    KB737435    ENN83024.1    KQ435699    KOX80578.1    APGK01013991    APGK01013992    APGK01013993    APGK01013994    APGK01013995    APGK01013996    KB739168    ENN82358.1    NEVH01020341    PNF21582.1    CH477341    EAT43090.1    AXCM01000046    JXUM01063153    JXUM01063154    KQ562234    KXJ76346.1    AAAB01008846    EAA06236.6    APCN01004943    AXCN02001396    AXCN02001397    ATLV01014688    ATLV01014689    KE524978    KFB39392.1    UFQT01002598    SSX33742.1    KQ434896    KZC10761.1    KZ288375    PBC26701.1    NNAY01004990    OXU17130.1    QOIP01000012    RLU15644.1    KK107558    EZA48978.1    DS233135    EDS28306.1    GL449658    EFN82264.1    GFDL01004514    JAV30531.1    PYGN01001038    PSN38237.1    GECZ01016223    JAS53546.1    GL435343    EFN73452.1    UFQT01000867    SSX27732.1    GDHC01017644    JAQ00985.1    KQ982316    KYQ57836.1    KQ981215    KYN44525.1    ADTU01002882    ADTU01002883    ADTU01002884    KC329816    AGG86916.1    GEBQ01019250    JAT20727.1    GL888237    EGI64238.1    KM280572    AJD25385.1    KQ976565    KYM80531.1    KQ765605    OAD53838.1    KQ979074    KYN22778.1    KX249688    AOR81465.1    CVRI01000020    CRK91249.1    KQ971338    KYB27779.1    GGMS01009469    MBY78672.1    JTDY01009830    KOB62560.1    GFXV01005326    MBW17131.1    JXJN01021660    JXJN01021661    CCAG010009340    Z80230    CAB02410.1    OUUW01000005    SPP80906.1    KA644906    AFP59535.1    CP012526    ALC48014.1    JRES01000338    KNC32158.1    CH940652    EDW59053.1    CH916374    EDV90994.1    BT126022    ADY17721.1    GFXV01003366    MBW15171.1    CH933806    EDW16292.1    CH479186    EDW39273.1    CM000070    EAL26747.2    CH954182    EDV53155.1    GBXI01007439    JAD06853.1    SPP80904.1    ABLF02038759    ABLF02038765    ABLF02038771    CH480819    EDW53434.1    BT150384    AGW52194.1   
Pfam
PF08344   TRP_2        + More
PF00520   Ion_trans
PF12796   Ank_2
PF00023   Ank
PF00088   Trefoil
PF07898   DUF1676
Interpro
IPR002110   Ankyrin_rpt        + More
IPR013555   TRP_dom       
IPR002153   TRPC_channel       
IPR005821   Ion_trans_dom       
IPR020683   Ankyrin_rpt-contain_dom       
IPR036770   Ankyrin_rpt-contain_sf       
IPR017957   P_trefoil_CS       
IPR000519   P_trefoil_dom       
IPR012464   DUF1676       
SUPFAM
SSF48403   SSF48403       
Gene 3D
PDB
6G1K     E-value=2.20102e-39,     Score=405

Ontologies

Topology

Length:
249
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
28.02129
Exp number, first 60 AAs:
4.55519
Total prob of N-in:
0.51181
inside
1  -  68
TMhelix
69  -  91
outside
92  -  249
 
 

Population Genetic Test Statistics

Pi
153.611061
Theta
122.623004
Tajima's D
0.754317
CLR
0.080592
CSRT
0.591420428978551
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号