SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08341
Pre Gene Modal
BGIBMGA006276
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.555
 

Sequence

CDS
ATGCTGAAGGCTGATGCACCGAGATCTGCAAGCTTGCTATATCCGCTCATCGTAAGGATTTGGGAGACTGAGCAAATACCGTCTCAATGGAAGCAGGGACTACTCGTGAAAGTTCCGAAGAAGGGCGATTTGTCTTCTTGTGACAACTGGAGAGGCATTACACTTCTTCCTTGCGCAGCAAAGGTCTTGGCTAGATTACTTCTAAACCGGATGTCCAAAAAGATCACTGGAACTCTTCGGGAGGAGCAAGCAGGTTTCTTACCGGGCCGATCATGCACAGACCATACAAACACTCTTCGCATCCTCATAGAACAAAGTGTCGAATGGCAGACTGAAATGATTCTTACGTTTGTAGACTTTGAGAAAGCGTTTGACACTGTACAGTGGAGCAAAATGTGGACCTGCTTAAAACAAAGAGGTATACCAAATAAAATCATTGGTATAATCCAGGCCTTATACAGAGGTAGTACATGTAGAGTCGTGCATGACCAAGTCCTGGGAGCCCCTATTGAGATGACAGCGGGTGTTAAGCAGGGCTGCCTCCTGTCTCCGCTACTATTCATTATGTTACTGGATGACATAATGCGGGAAGTGGTGACGACACCTCGGGGCATTGAATGGAGCGAAAATATCTTGGAAGACCTTGACTATGCAGATGACATAGTGTTGATGACGCCAACTTTGGATCAAATGCAAGCAAAACTTGAAGACCTCCGTATATCTGCGGAGAAAAGAGGCTTGCGTATCAACACCAACAAAACTGTCGACATGCGAGTAATGTCAAAAAACACTACTCCCCTAAAGCTCCAAGACTGTGTGTTGAAGTCAGCACAGAAGTTTACATATCTGGGGAGCTCCATATCAAATCAGGGTGGTTCGGACGAAGATATAGAGATACGAATTAGGAAAGCCAGGGGTGCTTTCGCGCAGTTGAAACCAGTCTGGGAGTCAAGTGTCATGACTCGTCGGATCAAGCTGACCCTGTTCGACTCCATTGTCAAGAGTGTTCTCCTGTTCGGATGTGAGACCTGGAGAGTGACCAAGACACTCACGAACCGACTGCAGGTATTTGTAAATAAGTGCTTGAGGTCGATACTCCGCATATACTGGCCAGTCACTATCTCTAATAAAGACCTTTGGACTAAATGCGACCAAAATCCCATCGCGCAAGACATTGCTCATCGGAAATGGCGTTGGATAGGACACACTCTACGGCGCAGCGGAGTCAACGCAGCATCAATCGCGTTTGAGTGGCAACCGCTTGGCAGGAGAAGACCTGGTCGCCCTGTACACACTTGGCGACGCACCGTAGAGAGTGAGATGAGGACTGCCAACGTGACCTGGAGTGATGTCAAGGAGCAAGCGCAAGACAGAGTAAAGTGGAGACAACTTGTGAGGGCCCTATGTACCAGCGGGGTACCCTAG
Protein
MLKADAPRSASLLYPLIVRIWETEQIPSQWKQGLLVKVPKKGDLSSCDNWRGITLLPCAAKVLARLLLNRMSKKITGTLREEQAGFLPGRSCTDHTNTLRILIEQSVEWQTEMILTFVDFEKAFDTVQWSKMWTCLKQRGIPNKIIGIIQALYRGSTCRVVHDQVLGAPIEMTAGVKQGCLLSPLLFIMLLDDIMREVVTTPRGIEWSENILEDLDYADDIVLMTPTLDQMQAKLEDLRISAEKRGLRINTNKTVDMRVMSKNTTPLKLQDCVLKSAQKFTYLGSSISNQGGSDEDIEIRIRKARGAFAQLKPVWESSVMTRRIKLTLFDSIVKSVLLFGCETWRVTKTLTNRLQVFVNKCLRSILRIYWPVTISNKDLWTKCDQNPIAQDIAHRKWRWIGHTLRRSGVNAASIAFEWQPLGRRRPGRPVHTWRRTVESEMRTANVTWSDVKEQAQDRVKWRQLVRALCTSGVP

Summary

EMBL
FJ265558    ADI61826.1    RQTK01000143    RUS86294.1    RQTK01000073    RUS88821.1    + More
RQTK01000294    RUS82268.1    RQTK01002506    RUS68506.1    GBRD01016432    JAG49394.1    UZAG01003391    VDO15268.1    GAKP01012607    JAC46345.1    LSMT01001244    PFX12648.1    LSMT01000478    PFX17357.1    LSMT01000038    PFX31239.1    BN000794    CAJ00236.1    LSMT01000057    PFX30003.1    UZAI01017336    VDP23465.1    UZAI01002802    VDO74779.1    FN356221    CAX83710.1    UZAK01037594    VDP59172.1    AAGJ04045270    UZAI01020046    VDP49350.1    RQTK01000031    RUS90495.1    UZAK01034022    VDP41775.1    RQTK01000034    RUS90383.1    UZAI01004764    VDO87718.1    LSMT01000205    PFX23506.1    UZAH01027236    VDO89910.1    UZAI01000872    VDO57178.1    RQTK01000780    RUS74991.1    UZAK01033233    VDP35612.1    UZAK01051765    VDP81150.1    UZAI01017296    VDP23041.1    UZAI01018356    VDP36181.1    GBHO01029816    JAG13788.1    UZAI01009733    VDP05700.1    UZAK01045225    VDP73636.1    UZAI01020438    VDP51493.1    QMKO01003083    RTG81912.1    UZAI01018128    VDP33575.1    UZAI01000214    VDO50020.1    MRZV01000013    PIK62384.1    UZAI01001589    VDO63472.1    AFYH01088828    MRZV01002040    PIK34921.1    UZAK01032331    VDP26045.1    UZAI01007972    VDP00733.1    UZAI01018929    VDP41391.1    PFX12647.1    UZAI01017961    VDP31522.1    RJLM01000070    RWX52695.1    UZAI01000099    VDO48517.1    RQTK01000418    RUS79972.1    UZAK01032715    VDP30433.1    UZAI01002257    VDO69787.1    UZAK01041924    VDP67956.1    UZAI01005620    VDO91334.1    QFLI01000039    PXX94708.1    UZAI01001449    VDO62065.1    UZAK01033448    VDP37335.1    UZAK01032269    VDP25249.1    UZAI01001688    VDO64417.1    UZAI01005753    VDO91851.1    UZAI01000669    VDO55444.1    UZAI01002313    VDO70304.1    UZAI01004395    VDO86019.1    JARK01001398    EYC09120.1    NIRI01002339    RJW62253.1    NIRI01001987    RJW64224.1    GGMR01000126    MBY12745.1    GBRD01000202    JAG65619.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR027124   Swc5/CFDP2       
IPR005135   Endo/exonuclease/phosphatase       
SUPFAM
SSF56219   SSF56219       
Gene 3D
PDB
5HHL     E-value=5.86391e-05,     Score=112

Ontologies

Topology

Length:
474
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0477000000000001
Exp number, first 60 AAs:
0.01747
Total prob of N-in:
0.00491
outside
1  -  474
 
 

Population Genetic Test Statistics

Pi
233.711777
Theta
142.143461
Tajima's D
2.020193
CLR
55.028248
CSRT
0.886655667216639
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号