SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08336
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.688 Nuclear   Reliability : 1.83
 

Sequence

CDS
ATGACAGCCGAGATGCTTCACACAGACATAGCAGGACCGATCAGACATCAAGGACCTAATGGTGAAAAATATTTTATGACAATTATTGACGATTTCTCTCATTTTTGCGTGTTTGCCCTGAAGAGCAAATCTGAAGCAACAGAACGACTGATGAACTATGTATTAAGAATTGAAAACGAAACGGGGAATAAAGTAAAAAGAATTAGATGCGATAATGGTGTAGAGTACACTGCTAATAGTTTGAAACTTTTTTGCATAAATAGAGGTATTAGTTTAGAGTATACATTACCATACACGCCACAACTTAATGGCATATCAGAAAGGATGAACCGCACATTATGCGACAAAACGAGGACTCTATTAGCGGAAACCAATTTGCCAAAACATCTGTGGTGCGAAGCAATACAATGTGCAGTTTACCAATTAAACAGATCGCCATCATGGGCCATAAGCTTCAAGACACCCAGCGGAATATTTTTTGGTAAAAACGACCTATCGAGATTGAGAGTATTTGGTTCCAAAGCTTGGGCTACTATAGTACCCAAACCGGACAAGTTAGCCAAGAGATCAAAAGAAACAAGAATGGTAGGTTATGGAACTGTTGGTTACAGATTATGGGATCCAGAAGAAGATAAAATAGTTATTTCCAGAGATGTAAGATTTGATGAAAGCGAGATTAAATTCAAAAATAACGAAGAAGTGAAACAAGTAAGATATATCCAAGACAAAGAAGAAGAAATCAATAAAGAAAAGGAAGATATTGTAGAACAGGAAGATGAATTTAAAGATGCAGAAATGAACACTGATCAAACTGAAGAAACAATAATCAGACCCAAAAGAACGATAAATCCTCCTGCTTATCTTAAAGATTACGAGACGAATATAGAAAACATAAATGAAACTAATATTGTTATATGTCTGAGTGCAAATGCACCAGAAACTTTCGAAGAAGCTATAAAAGAACCAGAATGGAAAAACGCAATCAAGAAAGAGCTAGATGCACTCCAAAGACTAAAAACGTGGGAAGAACAAGAAATAACCGATGGAAGAAAGCTCATAGATACAAAATGGATATTTAAACAAAAAGAAGATGGAACAAAAAAGGCAAGACTGGTAGCTAGAGGCTTCCAACAAAAGAAAAAAGATATTTTTGACAGCGTTTATGCACCCGTTGCTAGACATTCGACCATAAGAATGATCTTATCAAAAGCTGTACAAGATGATTTAAAGATTATTCAGCTAGATATTCCCACTGCATTCCTAAATGGAAAATTGAAGTCTGATGTATTTATCAAAATACCCCAAGGATTAGAAATAAAAAATAATAATACAGCATTAAAACTAAAGAGAGCATTGTATGGATTGGTTGAATCACCAAAATGTTGGAATGAAACAATCGACGAATTTGCGAAAGCTAAGGGATTCCAAAGATCAGAATATGATTACTGTTTGTATTACAAAGAAGATTGCTGGATGCTGATTTACGTGGACGATATCCTAATCATTGGAAACGGGGAAGATATTATTAAAGCACTTAAGGAGAAGTTTAACGCAAAATATATGGGCGAAATTAAGAACTTTCTCGGAATGGAAGTTAAAAGAAATGAAGATACCTTAGAACTGAAACAAACTAAAATGATTGAAAAGATATTGACTAAATTCAAAATGGATGAATGTAACGGAATTAAAACTCCCATGGAAAGAAATTACAATATAGAAATAAAGGACAATACAGAAGTTTTGGACGTACCGTATCGAGAACTAATAGGAAGTTTAATTTATCTTACTGTAACAACAAGACCGGATTTAACATTTGCAGTGTCATATCTGAGCAGATTTTTAGATAAACCGAACGAAGAATTATGGAAAGCTGGAAAAAGAGTAGTACGTTATTTGAAAGAAACAAAAGAAAAAGGATTATTATTTAAAAAGACAAATGACAATAATTTATACGGATTTTCTGATGCCGATTGGGCTGGAGATAGAAGCGACAGAAAAAGTGTTAGCGGTGGTATTATCCTACAAGGGCAAAACCCCATTGCTTGGTTTTCAAAGAAGCAACAATGCGTAACTTTATCGTCTGCTGAAAGCGAGTATGTAGCCGCCGCATCATTAGCACAGGAAATTGTTAATTTAAAAGGCATATGTAAGCACCTAGGTTGTGATGTAAATGCCGTGCTATTTGTTGACAACAAAAGTGCAATATCAATGGCCAAGAATTACGAGAACTCTAAGCGTACAAAACACATTGACATACGGTTTCATTATATAAAAGACTTGGTTGTCAATAAGGTGATCAGCATAGAACATATTTGTACCAATGAAAATTTAGCGGATGTTATGACTAAAAGTTTGAGCACAGACAAGTTTTATAAATGCATTAATAAGTTTTTGTGCTAA
Protein
MTAEMLHTDIAGPIRHQGPNGEKYFMTIIDDFSHFCVFALKSKSEATERLMNYVLRIENETGNKVKRIRCDNGVEYTANSLKLFCINRGISLEYTLPYTPQLNGISERMNRTLCDKTRTLLAETNLPKHLWCEAIQCAVYQLNRSPSWAISFKTPSGIFFGKNDLSRLRVFGSKAWATIVPKPDKLAKRSKETRMVGYGTVGYRLWDPEEDKIVISRDVRFDESEIKFKNNEEVKQVRYIQDKEEEINKEKEDIVEQEDEFKDAEMNTDQTEETIIRPKRTINPPAYLKDYETNIENINETNIVICLSANAPETFEEAIKEPEWKNAIKKELDALQRLKTWEEQEITDGRKLIDTKWIFKQKEDGTKKARLVARGFQQKKKDIFDSVYAPVARHSTIRMILSKAVQDDLKIIQLDIPTAFLNGKLKSDVFIKIPQGLEIKNNNTALKLKRALYGLVESPKCWNETIDEFAKAKGFQRSEYDYCLYYKEDCWMLIYVDDILIIGNGEDIIKALKEKFNAKYMGEIKNFLGMEVKRNEDTLELKQTKMIEKILTKFKMDECNGIKTPMERNYNIEIKDNTEVLDVPYRELIGSLIYLTVTTRPDLTFAVSYLSRFLDKPNEELWKAGKRVVRYLKETKEKGLLFKKTNDNNLYGFSDADWAGDRSDRKSVSGGIILQGQNPIAWFSKKQQCVTLSSAESEYVAAASLAQEIVNLKGICKHLGCDVNAVLFVDNKSAISMAKNYENSKRTKHIDIRFHYIKDLVVNKVISIEHICTNENLADVMTKSLSTDKFYKCINKFLC

Summary

EMBL
AB014676    BAA74713.1    GDHC01015802    JAQ02827.1    GBHO01027564    JAG16040.1    + More
GEDC01012841    GEDC01000503    JAS24457.1    JAS36795.1    GBHO01004832    JAG38772.1    GDHC01007058    JAQ11571.1    GDHC01019310    JAP99318.1    GBHO01035173    JAG08431.1    GFTR01008662    JAW07764.1    RSAL01000408    RVE41872.1    GBHO01036606    JAG06998.1    GBHO01036607    JAG06997.1    GDHC01005985    JAQ12644.1    GDHC01015473    JAQ03156.1    LJIG01022881    KRT78250.1    GEZM01032204    JAV84770.1    GEZM01009498    GEZM01009497    JAV94551.1    GEZM01009496    GEZM01009495    JAV94560.1    GEZM01072005    JAV65635.1    OIVN01001052    SPC89229.1    OIVN01004879    SPD19723.1    OIVN01002680    SPD05612.1    OIVN01000183    SPC75833.1    OIVN01001196    SPC91020.1    OIVN01000557    SPC82046.1    OIVN01002854    SPD06945.1    OIVN01002904    SPD07378.1    OIVN01002256    SPD02034.1    OIVN01003569    SPD12194.1    OIVN01001309    SPC92453.1    GEZM01028916    JAV86196.1    OIVN01001666    SPC96375.1    OIVN01005059    SPD20680.1    JXUM01136904    KQ568499    KXJ68982.1    OIVN01005657    SPD23465.1    KQ483843    KYP40337.1    JXUM01155348    KQ572178    KXJ68066.1    OIVN01000036    SPC73022.1    OIVN01004867    SPD19656.1    NKQK01000002    PSS35035.1    OIVN01005591    SPD23209.1    JXUM01118474    KQ566190    KXJ70335.1    OIVN01002940    SPD07631.1    OIVN01001534    SPC95017.1    OIVN01005024    SPD20514.1    GFTR01008327    JAW08099.1    FJ544853    ACL97384.1    OIVN01000116    SPC74628.1    KK112142    KFM56833.1    NKQK01000016    PSS08126.1    OIVN01003897    SPD14257.1    OIVN01001022    SPC88819.1    QGNW01000228    RVW83440.1    OIVN01004420    SPD17230.1    FJ544856    ACL97386.1    FJ544854    ACL97385.1    GEHC01000959    JAV46686.1    FJ544851    ACL97383.1    ASHM01015075    PNX96991.1    DF973268    GAU23361.1    OIVN01006233    SPD28466.1    CM003603    KYP77007.1    ABLF02041793    KQ484038    KYP38095.1    AGCT01070466    KYP79141.1    JYDK01000067    KRX78390.1    LSMT01001145    PFX12880.1    OIVN01002547    SPD04547.1    OIVN01006466    SPD33659.1    OIVN01004651    SPD18552.1    OIVN01001308    SPC92446.1    GEZM01063091    JAV69316.1    OIVN01001931    SPC99063.1    KL367515    KFD67411.1    CM007893    OTG30017.1    QGNW01000770    RVW62496.1    JN402333    AFB73912.1    FJ544857    ACL97387.1    CM003605    KYP71150.1    KQ484186    KYP36645.1    ASHM01002084    PNY07765.1    CM003607    KYP67664.1    ASHM01007852    PNY15642.1    OIVN01004379    SPD17029.1    NEVH01013252    PNF29308.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    GBHO01040574    JAG03030.1    GBHO01040573    JAG03031.1    KQ483417    KYP53032.1    OIVN01002055    SPD00174.1    KQ483702    KYP42748.1    QGNW01000129    RVW93423.1    DF974079    GAU44848.1    QGNW01002195    RVW23445.1    QGNW01001602    RVW35576.1    QGNW01001787    RVW30779.1    PDCK01000041    PRQ42077.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF13855   LRR_8
PF03106   WRKY
PF13358   DDE_3
PF00931   NB-ARC
PF18052   Rx_N
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR025724   GAG-pre-integrase_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025314   DUF4219       
IPR032675   LRR_dom_sf       
IPR036576   WRKY_dom_sf       
IPR001611   Leu-rich_rpt       
IPR003657   WRKY_dom       
IPR038717   Tc1-like_DDE_dom       
IPR002182   NB-ARC       
IPR027417   P-loop_NTPase       
IPR041118   Rx_N       
IPR017451   F-box-assoc_interact_dom       
IPR011009   Kinase-like_dom_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF118290   SSF118290       
SSF52540   SSF52540       
SSF56112   SSF56112       
Gene 3D
PDB
5HRR     E-value=4.9033e-06,     Score=123

Ontologies

Topology

Subcellular location
Nucleus  
Length:
799
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.003
Exp number, first 60 AAs:
0.00039
Total prob of N-in:
0.00015
outside
1  -  799
 
 

Population Genetic Test Statistics

Pi
374.112521
Theta
154.406968
Tajima's D
4.505979
CLR
10.31468
CSRT
0.999850007499625
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号