SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08331
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.032 Nuclear   Reliability : 1.528
 

Sequence

CDS
ATGATGGCAAACTTAAAAATAAAATTACCCCAGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGGAGCATGCTGCCCCGCGTATTCTGGGGGGGGCAAAGCATGCCACGATGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGACAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGAAGGCGAGGCGGCTGGTCCGAAAGGGACAACCGCCAAGAAGATTAGGCGGAAGAGGAAGTCTTGGCGAGCTTCCTCTCGTGAGGGGGTAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAAAAGGTGTTGGTAATCTCCGATGCAGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAGAGGGAGACCCGCCCGGAAAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTGTCAATGTCTGTCGCCTCGTTGGATGGGCAGACGACAGAGGAGGAAGAGAGCGGCCTTCAGGATCCTGCCATGGTCATAGACAGGGCCATGAAGACCGTGAAATCATACGCGGCCAATGGCACCAAGACCAAAGCCGCTGGTCGTAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAAGTTCTGCCATCAGTTGCTTCTGCCAATGACCAGGTGGTACAGCTGATGGCGGAGAATTTGAGACTTCGAGCACAGCTCCAAGCTCGGCAACGGCCCGATGATGGAGCAGCGACGTCCTGGGTCGCTGGAGCCCCTCGGAGCTCCCGTCTCCCGGCGCTGACTAGTGATCAGTGGCCTGTGCTGCCACCACCGCGTGCGGCACAGGAGCGTCCGCGTCTCCCGTCACCGCGCTCTAGAGAGACGACCGCCGCCGCGCGGCAGCAAGCACTCGCGGGGCCACGGATGCTGGCTCCGCCAGAACCGAAGACCTTCAGCCTGGACGAGGTCATCAACCGCACCGTCCAGGCTGTAGTAGAAAAGCTGGGCGGGAGGCTAGCGGCTCTCGAGGCGAGAGTGACTGTTTCGGCCGACGTTAGGCAACCGGCGGTGACGGGTGCTTTGGCCACCCGTTCCGCTCCCGTACGGGCTCCGGCCACCAGGTCGGGCCCGGGACGGGATCGAACTAAGCGAGGGGGCGGCGCTAACGCGAAGCCTCCATCACAAGCACCCCAGTCCCGTCCGCTGCCTCCGCCCCCGTCAGACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTGCCAAAAAGGCCTCACTGGCAGCTCCCCAAATGGGTAGAGCGCCAGTGGCCATGGCGGTTCAGGCTGCACCCCAACAGGGTCGAGCACCTGTAGCCGCCAAGAAAAACAAAAAAACAAAAAAAAAAGGGAAGAAGTCGTCGCGGGCGCCGCGATCAGCGGCAGTGGTTCTAACTTTACTGCCTGCCGCTGAGGCCAAGGGCATCACATATAATGATGTGATGGCCCGGGCGCGTGAAGCAGTCAACCTGGACGAGATTGGGGCGGAGGAGGGCCTCCGCAGCAGGCAGACGGCCAATGGGGCCAAGCTGTTAGAGTGTCCCGGTGCCGATAGTCCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCTTGCCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTAAAAATGGCGGAATTAAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGAGAGCGGCCGTCGCTACCCAGGGCAACTGTGCACCGGAGAATGTAACCGTGGGTGAGCTGCGCCGTGGTTATAACGGGGCCAGCTCAGTGTGGGTGCGTTGCCCGTTGGAGACGGCTGCCTCCCTGGCTGCTCCTCCGCCCGGGGGACCGTCGGGGAATCCAGGCAGGCTGCGCGTGGGCTGGATAGCGGCCCACGTGCGCCTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGTCTCGCCAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCGCGGCCGCCCCGCACTGCGCTCTGTGCGCTGCGGCCGGGCGCGGGGCTAACCACCGGGCGGGAGGAAAGGCGTGCCTCCCGTCCGGTGATAACACCGAACGCAACCGGCACCGGAAGTCAAAGCGCCGGCAGAGGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCACCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGTATGGCGGAGTGGTCTATAGATGTGGCTGTGGTCGCCGAGCCATATTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGCCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGATCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCACAGTCGCGGACGTCCATGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGATTGCGTTCGCGGCAGCAGAGGCCCGGCTGCACGGCGCATTCCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCTACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGTGCTTTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGTGAAGTCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGCGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTGGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACATGGCGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATATGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGTGGCGCATGTCGTCGGCAAAATTAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGCTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAGGTGGCGGGCTGAACTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCACGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTTACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGAGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMANLKIKLPQEGTTLGGESLRASTSVGACCPAYSGGGKACHDEGGCATGSGKPVEPRCDSAGSTRSALVSEGEAAGPKGTTAKKIRRKRKSWRASSREGVGEPASSSGADAPPEKVLVISDAASAAEEMPPPRGRPARKRGAPSPAPSSVSMSVASLDGQTTEEEESGLQDPAMVIDRAMKTVKSYAANGTKTKAAGRKLREVVSQVSKVLPSVASANDQVVQLMAENLRLRAQLQARQRPDDGAATSWVAGAPRSSRLPALTSDQWPVLPPPRAAQERPRLPSPRSRETTAAARQQALAGPRMLAPPEPKTFSLDEVINRTVQAVVEKLGGRLAALEARVTVSADVRQPAVTGALATRSAPVRAPATRSGPGRDRTKRGGGANAKPPSQAPQSRPLPPPPSDMDEGWNVVARRGAKKASLAAPQMGRAPVAMAVQAAPQQGRAPVAAKKNKKTKKKGKKSSRAPRSAAVVLTLLPAAEAKGITYNDVMARAREAVNLDEIGAEEGLRSRQTANGAKLLECPGADSPGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVRAAVATQGNCAPENVTVGELRRGYNGASSVWVRCPLETAASLAAPPPGGPSGNPGRLRVGWIAAHVRLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCAAAPHCALCAAAGRGANHRAGGKACLPSGDNTERNRHRKSKRRQRRKLARGALANAVIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIAIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSTVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRRRRLPRRNDPIAFAAAEARLHGAFRVAQRALQLAIRRAKNLHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSVLFPQEREGFVAPAMDAPPDYDGEVPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYRWRAELRARGVARPSPSVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
1WDU     E-value=6.64735e-11,     Score=168

Ontologies

Topology

Length:
1805
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.15968
Exp number, first 60 AAs:
0.00016
Total prob of N-in:
0.00002
outside
1  -  1805
 
 

Population Genetic Test Statistics

Pi
164.701977
Theta
116.849613
Tajima's D
0
CLR
116.572094
CSRT
0.378181090945453
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号