SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08319
Pre Gene Modal
BGIBMGA011165
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 2.412
 

Sequence

CDS
ATGAGGCTTGTATGGTACTCGTGTCTTGCCCTTTTCGGTTTGATTACAGCTAAAAAATTTGGTTGTGACAAGAATCTGGATCCTGCCGATGATCCGAAAAACATCGAAAGACCTTGTCCGAACTTCGACTTAGACTGTATTCGAGAATATTTCTCTAGTAATTCAAAATGTCAAATAGCACGGGAGCCAGTACCGGATCCACTGCTTCTCAACCATTACAGATTAAACATAGCAAATTCTAATATAACTATGGAACTCAATAATGTAGAAGTCGGAGGTCTTAATGGAAATATTGTTGAGTTTTATATAAACAAAGAAACTCAGAAACTGGTATTGGTAATAGAAGTGGACTCTGTAAGATTGGAATCGATACAAGTAACATTCAAGTACAATAGAAAGGGTAAAGAGCCCATTGTGAGAAGTGATAATGCCACGTGTGATTACGGACCTATGAGTTTTACTGTGGTGTTTCCGAGCATCTGCGATCTTGATTTGAACAACGCCGAAGTTTTCACGTACATTGAGGATTGTAACACGAAATATACAATGGGAATAGGTCTATATTCCAGTTTGGATCCAAAGATGTCTCAAGAGATCTACAGAGTTGGTGTGCGCATTCCGCCATTCTGCTCAGAGGACCCAGAAATGTGGTTCAGTCAGATAGAGATGCAATTTAAGCTCTCAGGGATATCTGTGGACGATACTAAGTTTACGTATGTGTCAGCGAACCTGGAACCACAGTACGCCAAGGAGGTAAGAGACATCATAACGAAACCGCCAGCTTCAAATAAATACGAAAAACTCAAAACAGAGCTGATCAAGCGACTATCAATATCACAGGAGAAGCGTGTAAGACAACTTCTCATGCACGAAGAACTCGGAGATCGGAAACCGTCTCAGTTTCTACGCCACTTGACAAGTCTAGCTGGTTCAGACGTTCCATCTGATTTTATAATAACTATCTGGACCAGTCGTCTGCCTGTGAACGTGCAAACAGCAGTCGCTACGATTAAAGGATCGTCAATGGAGAAGCTAAGTGACTTGGCAGATGTCGTATATGAAATGGCCCCAACAGTACCACAGGTGGCAAGCGCGTCTTCCCAAGCCCAAGGCAATGAGCAAGGCAATCCGACGATGACTGAGATGGCCCAGCAAATCAATTCGCTGACACAGCAAATCAGCATGCTCTCTAAACAGTTTCGCGTCGGAAAACTCCTGGGGCGGTCGGAAGTAGCGGCCAACGACTGCCCACATTCTTCAGGCCGTCTTTTTATCACCGACCGTACTTCAAAAATGCAGTTCCTAGTGGACACTGGTTCCGATTTGTGTGTTTTTCCACGGTCGGCTGTGAAGGCGCCCTGTACCAAGTCGAAATATGATCTCGTAGCCGCGAATAATTCTATTATACACACCTATGGCCCTGTAACTCTTCATTTAGACTTTGGACTAAGAAGAGACTTCGCGTGGAAATTCACTGTTGCAGACGTATCTAAGCCCATAATCGGAGTGGATTTCTTGTCTTACTACAACTTACTCGTCGATTGCAGAAAACAACGTATTATTGATGGCATCACTTCTCTGTCTGCAGTCGCGACACCTATCGGGATGACTAAAGACCTTCCTTCTGTCAAAGCCGTCACTGGTGAAACTGACTTCCACGATATTCTGAGAGAGTTCCCAGAAATCACAAGGCCAGCAGGTATGCTCTCTACCACATTTAAGCATAACACCGTTCATCATATTAGAACTACACCGGGACCTCCCGTTGCTTGCAAGCCTCGACGTTTGGATCCAGCACGTATGCAAGCCGCGAAGAAAGAGTTCGAGGATATGTTGGCAAGCGGCGTAGCCCAGCGTTCAGAGAGTGCATGGTCTTCTGCTCTGCACTTGGTAAAGAAGAAAGATGACGGATGGCGTCCTTGTGGCGATTACCGATCACTGAATGCGAGAACGATACCTGATAGATATCCAGTACGCCACATCCATGACTTCTCACAACAGGTTTCTGGATGTTCCATCTTTTCTAAAATTGATTTGGTGAAGGCTTATCATCAGATAGCCGTTAATCCTGAGGATATACCTAAAACAGCCATCACTACTCCTTTTGGACTTTTCGAATTTCCATTTATGACCTTTAGTTTGAGGAATGCCGCTCAGACATTCCAAAGGTTCATAGATGAGGTGCTACTAGGCCTCGACTTCACCTATGGATATATTGATGATATATTACTGTTTTCTTCATCGCTAGAGGAACATAAGTGTCATCTACGTCAACTCTTTGATCGTCTCCGGCAGTATGGCATTCTGGTGAACACAACTAAATGTACTTTTGGTCAATCTGTCGTGGAATTCCTAGGATATGAAGTATCTGCTACAGGTACTAAGCCATTGGACACTAAAGTCCAAGCTATCCAGGAATTTCCTGCTCCTAAAACGGTGAAGGAACTCCGAAGATTTTTAGGCATGCTTAATTTCTACCGCCGTTTCATACCTAACGCCGCCCAGTTACAAGCTCCGTTGAACAACGCTCTGGCAGGAGTTAAAATGAAAGGTTCACACCCTGTGGATATGGATGCAGTCATGTTAAAAGCCTTTGAGGACTGTAAGACTTCTTTATCTCAGGCAACGCTTTTGTCTCATCCGGATCCAACCGCCGATCTTGCGATTGTCACTGACGCGTCTCTCACAGCGATTGGAGCTGTTCTACAACAAAGGAAAGGTGAACATTGGGAACCACTCGCTTTCTACTCCCACAAGCTTAGTTCCACCCAATCGAAGTACAGTCCATATGATCGAGAATTACTGTCAGTTTATGAGGCAATAAAGCACTTTCGACACATGATTGAAGCGAGAAATTTCACCGTCTTCACTGATCATAAACCGCTGATCTTTGCCTTCTCAGTAAACAGGGAGAAATGTTCACCAAGGCAATTCAGATATCTTGACTACATATCACAGTTTACTACGGATATTAAATATATACCTGGAAAGGATAACGTAGTCGCCGACGCACTTTCTCGGGTGGATGAAGTCGCTCCATGTATCGACTATGAACATCTTGCACGATCTCAGGAACAAGATCCAGAGCTGCAAGATCTTCTGCGTAATGGAAGTTCTCTAAAATTAGAAAAGTTATCTTCTGAGTATAGTAGCTTACCCGTTTATTGCGACACCAGTGTGCACCCTCCACGACCATTCATCACAAAAGATATGCGAAGACAAGTCTTCAACACACTACATGGACTTCATCACCCAGGATCGTCCGCTACAGTCCGACTGGTGGCGCAAAGATTTGTGTGGCCAGGGATTCGGAAAGACTGTAGAGAGTGGTCAAGACAATGCTTAAACTGTCAGAGAAGTAAAGTAAGTCGCCATACAGTTTCTCCTCTTTCCTCTTTCCTTACCCCTTCGTCAAGATTCACTCATATCCATCTTGACATCGTAGGGCCTCTAAATCTGTCTGCTGGTTTCAGGTACTGCCTCACTGTCATTGACCGCTTCACCCGATGGCCTGAGGTGATACCACTCAGCGAAATTACAGCTGAAGCTTGTGCTGCCGCTCTCGTTAGCGGCTGGATTGCCAGATTTGGATGTCCACTGAGAGTAACTACCGACCGCGGTCGTCAATTCGAGAGTCACTTATTCAAAGCCATAGCTGCATTAATAGGTGCTCACCACCTCCGGACTACCGCATATCACCCCGCCGCCAACGGAATAGTCGAACGAATGCATCGCCAGTTGAAGGCAGCCATCATGTGCCATACACCTTCGCAATGGACTGAAGCACTTCCTCTCGTACTGATGGGCATGCGCAGTTCCTGGAAGGATGACATTGACGCATCTCCTGCAGAGCTGGTGTACGGCGAGCCCCTCTGTCTGCCAGGTCAATTCATTTCACCAAATGAAGACTACAAAGTGTCTGACGTCACCCAGTATGCAACTCGTCTACGTGCATGCATGGCGAATTTGACACCGAGACCGACATCCTGGCATAGCAATTCACCATTTTATATACCTCGCGATTTACATACAACCTCCCATGTCTTCATCCGACAAGATCATGTGCGTGGTTCTCTGGTACCACCATATGCTGGTCCCTTCAAGGTTGTCAAAAGGCAGCCAAAATTCTTCACTGTCAAAGTTCGAGGGAAGCTTGTAAATGTCTCCATAGATCGTCTAAAGCCGGCCTATATGACGAGAGTTCCAGAAGATCGTGTAGCCGAAAGAGAGTATCAGAAACTGATAGCTTCTATGCCAGGTGCCGTTCTAGAAAGTTTTATCACGGAAGGAAAAAAATTCATGGACCATTACATACAATACAATATCTGCAACTTTGGATTAGAATTAGGCTGTGAATAA
Protein
MRLVWYSCLALFGLITAKKFGCDKNLDPADDPKNIERPCPNFDLDCIREYFSSNSKCQIAREPVPDPLLLNHYRLNIANSNITMELNNVEVGGLNGNIVEFYINKETQKLVLVIEVDSVRLESIQVTFKYNRKGKEPIVRSDNATCDYGPMSFTVVFPSICDLDLNNAEVFTYIEDCNTKYTMGIGLYSSLDPKMSQEIYRVGVRIPPFCSEDPEMWFSQIEMQFKLSGISVDDTKFTYVSANLEPQYAKEVRDIITKPPASNKYEKLKTELIKRLSISQEKRVRQLLMHEELGDRKPSQFLRHLTSLAGSDVPSDFIITIWTSRLPVNVQTAVATIKGSSMEKLSDLADVVYEMAPTVPQVASASSQAQGNEQGNPTMTEMAQQINSLTQQISMLSKQFRVGKLLGRSEVAANDCPHSSGRLFITDRTSKMQFLVDTGSDLCVFPRSAVKAPCTKSKYDLVAANNSIIHTYGPVTLHLDFGLRRDFAWKFTVADVSKPIIGVDFLSYYNLLVDCRKQRIIDGITSLSAVATPIGMTKDLPSVKAVTGETDFHDILREFPEITRPAGMLSTTFKHNTVHHIRTTPGPPVACKPRRLDPARMQAAKKEFEDMLASGVAQRSESAWSSALHLVKKKDDGWRPCGDYRSLNARTIPDRYPVRHIHDFSQQVSGCSIFSKIDLVKAYHQIAVNPEDIPKTAITTPFGLFEFPFMTFSLRNAAQTFQRFIDEVLLGLDFTYGYIDDILLFSSSLEEHKCHLRQLFDRLRQYGILVNTTKCTFGQSVVEFLGYEVSATGTKPLDTKVQAIQEFPAPKTVKELRRFLGMLNFYRRFIPNAAQLQAPLNNALAGVKMKGSHPVDMDAVMLKAFEDCKTSLSQATLLSHPDPTADLAIVTDASLTAIGAVLQQRKGEHWEPLAFYSHKLSSTQSKYSPYDRELLSVYEAIKHFRHMIEARNFTVFTDHKPLIFAFSVNREKCSPRQFRYLDYISQFTTDIKYIPGKDNVVADALSRVDEVAPCIDYEHLARSQEQDPELQDLLRNGSSLKLEKLSSEYSSLPVYCDTSVHPPRPFITKDMRRQVFNTLHGLHHPGSSATVRLVAQRFVWPGIRKDCREWSRQCLNCQRSKVSRHTVSPLSSFLTPSSRFTHIHLDIVGPLNLSAGFRYCLTVIDRFTRWPEVIPLSEITAEACAAALVSGWIARFGCPLRVTTDRGRQFESHLFKAIAALIGAHHLRTTAYHPAANGIVERMHRQLKAAIMCHTPSQWTEALPLVLMGMRSSWKDDIDASPAELVYGEPLCLPGQFISPNEDYKVSDVTQYATRLRACMANLTPRPTSWHSNSPFYIPRDLHTTSHVFIRQDHVRGSLVPPYAGPFKVVKRQPKFFTVKVRGKLVNVSIDRLKPAYMTRVPEDRVAEREYQKLIASMPGAVLESFITEGKKFMDHYIQYNICNFGLELGCE

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
Belongs to the histone H3 family.
EC Number
2.7.7.12
EMBL
LBMM01001181    KMQ96765.1    KQ971355    EFA07205.2    AAGJ04130731    KL363241    + More
KFD51254.1    AAGJ04001742    ABLF02030693    ABLF02030697    AAGJ04112098    AAGJ04172791    AY013563    AAK07485.1    DF142933    GAA49140.1    AY013569    AAK07487.1    AY013565    AAK07486.1    LBMM01012567    KMQ86146.1    AAGJ04000250    FN356213    CAX83702.1    KL367778    KFD59660.1    GEGO01003687    JAR91717.1    KL367543    KFD65158.1    KL367544    KFD65142.1    KL367552    KFD64647.1    JWZT01003175    KII67485.1    JWZT01002058    KII70465.1    ABLF02058233    ABLF02040931    ABLF02040938    KL367655    KFD60653.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01004124    KII64665.1    JWZT01001363    KII72172.1    ABLF02005645    ABLF02042063    KL367479    KFD72009.1    AAZX01013940    KL363373    KFD46409.1    JYDR01000002    KRY79251.1    KL367564    KFD63933.1    GACK01008900    JAA56134.1    AAZX01006801    AAZX01023483    GEGO01004475    JAR90929.1    ABLF02006352    ABLF02013150    ABLF02013854    ABLF02041505    AAZX01023279    JYDJ01000353    KRX36608.1    JYDT01000067    KRY86703.1    KL363454    KFD45607.1    KL363200    KFD55401.1    ABLF02057446    ABLF02059301    AAZX01009606    KL363318    KFD47658.1    FN356212    CAX83701.1    AAZX01023264    JYDV01000002    KRZ45603.1    ABLF02011086    ABLF02042879   
Pfam
PF17921   Integrase_H2C2        + More
PF17919   RT_RNaseH_2
PF01087   GalP_UDP_transf
PF00078   RVT_1
PF00665   rve
PF17917   RT_RNaseH
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF13359   DDE_Tnp_4
PF00125   Histone
PF16211   Histone_H2A_C
PF00077   RVP
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR034132   RP_Saci-like       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR005849   GalP_Utransf_N       
IPR001969   Aspartic_peptidase_AS       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001995   Peptidase_A2_cat       
IPR001937   GalP_UDPtransf1       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR041373   RT_RNaseH       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027806   HARBI1_dom       
IPR000164   Histone_H3/CENP-A       
IPR002119   Histone_H2A       
IPR032454   Histone_H2A_C       
IPR007125   Histone_H2A/H2B/H3       
IPR009072   Histone-fold       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF50630   SSF50630       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF47113   SSF47113       
PDB
4OL8     E-value=1.62127e-66,     Score=647

Ontologies

Topology

Subcellular location
Chromosome  
Nucleus  
SignalP
Position:   1 - 17,         Likelihood:  0.990027
 
 
Length:
1452
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10734
Exp number, first 60 AAs:
0.09044
Total prob of N-in:
0.00573
outside
1  -  1452
 
 

Population Genetic Test Statistics

Pi
278.958756
Theta
175.970472
Tajima's D
2.287252
CLR
0
CSRT
0.925653717314134
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号