SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO08318  Validated by peptides from experiments
Annotation
PREDICTED:_uncharacterized_protein_LOC105842476_[Bombyx_mori]
Full name
Fibrohexamerin      
Alternative Name
25 kDa silk glycoprotein
p25
Location in the cell
Nuclear   Reliability : 1.535 PlasmaMembrane   Reliability : 1.187
 

Sequence

CDS
ATGAAGTTAATGCTGTGTTTATGTCTTCTTTCGTTTTTCGGCTTGACTGTGGCGGATGAGGTAGACTGTGAATCTGATCTAGATCCGGCCGATGATCCGAGGAATATCGAAAGACCTTGTCCGAACTTCGACTTGGACTGTATTCGTAAATATTTCTCGAGTAATTCGAAATGTCAAATAACGCTGGGGCCAGTACCGGATCCGCTGCTTCTCAACAATTACAGATTAGATATAGCAAACTCTAATATTACCGCCCAATTTAACAACGTAAGCGTTCGAGGTCTCAATGGGAATATCGTTGAATTTTACATCAACAGAAAAACTGAGAAACTGGTTCTCGCAACAGAAGTGAAAAGCTTAGCATTTGATTCTCCACAGGTGGTATTTAAATACAACAGGAAAGGTAAAGAGCCCATTGTACGAGGTGACTGTGTGGATTGTGAATACGGAGCTGCAACTTTCACTGCTGTATTTCCAAGTATCTGCGATTTAGATCTGAGCAAAGCTGAAGTTTTCACCTACGTCGAAGACTCTAATCCCAGATATAAAATAGGATCACGACTATTTTCCATTTCTGATTCTGTGGCACTAAACGAGTTCCTAAAGTTTATAACGAGTATGTCGGAAAATATTCAAGAAAAGTTTATCTCGCAAGGAAGAATTTTTATGGCCAACTACATAGAATATAATATCTGTGACTTTGGATTAAATTTAGCATGTAAATAA
Protein
MKLMLCLCLLSFFGLTVADEVDCESDLDPADDPRNIERPCPNFDLDCIRKYFSSNSKCQITLGPVPDPLLLNNYRLDIANSNITAQFNNVSVRGLNGNIVEFYINRKTEKLVLATEVKSLAFDSPQVVFKYNRKGKEPIVRGDCVDCEYGAATFTAVFPSICDLDLSKAEVFTYVEDSNPRYKIGSRLFSISDSVALNEFLKFITSMSENIQEKFISQGRIFMANYIEYNICDFGLNLACK

Summary

Subunit
Silk fibroin elementary unit consists in a disulfide-linked heavy and light chain and a p25 glycoprotein in molar ratios of 6:6:1. This results in a complex of approximately 2.3 MDa.
Miscellaneous
It is unclear whether the N-terminal residue of the mature protein is Ala-17 or Gly-18.
Keywords
Complete proteome   Direct protein sequencing   Disulfide bond   Glycoprotein   Reference proteome   Secreted   Signal   Silk protein  
Feature
chain  Fibrohexamerin
Pfam
PF07294   Fibroin_P25
Interpro
IPR009911   Fibroin_P25        + More
IPR038606   To_sf       
Gene 3D

Ontologies

Topology

Subcellular location
Secreted  
SignalP
Position:   1 - 18,         Likelihood:  0.999442
 
 
Length:
241
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02123
Exp number, first 60 AAs:
0.00327
Total prob of N-in:
0.01009
outside
1  -  241
 
 

Population Genetic Test Statistics

Pi
290.424774
Theta
185.816286
Tajima's D
1.653556
CLR
0.22489
CSRT
0.818959052047398
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
25860555 EGGICTVAEDCPSDIR 100.00 0.008
27102218 KYFSSNSK 100.00 0.008
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号